1.Effect of get-well treatments on the suffers after thorax operation over 70 years old
Yuqin LIN ; Wen FANG ; Ting CHEN
Chinese Journal of Primary Medicine and Pharmacy 2008;15(7):1103-1104
Objective To investigate the application of get-well treatments in the suffers after thorax opera- tion over 70 years old. Methods 68 suffers after thorax operation over 70 years old were divided to two groups. Comparison group( n = 32 ) is actualized general nurse. Experiment group( n = 36) is actualized lung function exercise before operation, and get-well treatments after operation, such as psychologic get-well, deep breath, abdominal breath, effective cough and sputuming, applying apparatus training breath; exercise limbs and body, atomization in- breath, and so on. Results The suffers in experiment group who have lung atrophy,lung infection, liquid in the tho- rax,the time in the hospital and the time holding thorax pipe are less than the suffers in comparison group. Conclu- sion Lung function exercise before operation and effective get-well treatments after operation have significant ef- fects on old suffers.
2.Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis
Qi-Ji, HUANG ; Liang-Xuan, CAI ; Ting-Wen, LIN
International Eye Science 2016;16(6):1190-1192
? AIM: To explore the curative effect of dacryocystorhinostomy under endoscopy with mitomycin for the treatment of chronic dacryocystitis.?METHODS: Totally 73 cases ( 78 eyes ) with chronic dacryocystitis were treated with dacryocystorhinostomy under endoscopy with mitomycin and followed up for 6-12mo.?RESULTS: In the 73 patients, 66 cases with 70 eyes (90%) were cured, 2 cases with 3 eyes (4%) improved, 5 cases with 5 eyes ( 6%) not changed. In the recurrent 5 eyes, 2 eyes were treated under endoscopy to remove granulation, enlarge the opening, then anesthetic tube was placed after cotton sheet with 0. 4g/L mitomycin was put on the incision for 5min. The rest 3 eyes were treated in superior hospital with laser, and all were successful. There was no severe complication observed.?CONCLUSION:Dacryocystorhinostomy under endoscopy with mitomycin for chronic dacryocystitis is effective.
3.Association of sleep quality with type 2 diabetes mellitus
Ya ZHANG ; Pan ZHANG ; Peian LOU ; Lin LIU ; Jie LIU ; Zhihua WEN ; Ting LI
Chinese Journal of Health Management 2014;8(5):305-309
Objective To explore the association between sleep quality and the increasing risk of type 2 diabetes mellitus (T2DM).Methods A total of 771 patients aged 25-70 years living in Xuzhou City of Jiangsu Province for at least 5 years were enrolled for the survey of risk factor related noninfectious chronic disease in 2013.In this investigation,those who suffered from other types of diabetes,neuropathy,other endocrine disease,cardiovascular,renal and hepatic dysfunction,dyspnea or cancer were excluded.To reduce the influence of confounding factors,another 771 participants were enrolled as controls.Each case was arranged to have a control who was matched in age (difference not more than 3 years),gender,residence and family history.All the participants were interviewed with self-designed questionnaire,and sleep quality was measured by Pittsburgh Sleep Quality Index (PSQI) questionnaire.Student's t test,Chi-square and multivariate logistic regression were used for data analysis.Results The PSQI score in the T2DM patients vs.the controls were 5.15±2.40 vs.2.71 ± 1.93 (t=21.96,P<0.01).The scores of sleep-related factors,including subjective poor sleep quality,bedtime resistance,short sleep duration,sleep efficiency,sleep disturbance,use of sleep medication and daytime dysfunction,of the T2DM patients were higher than those of the controls.The proportion of sleep related behaviors of the T2DM patients was higher,except for early awakening,cold feeling and nightmare.Poor sleep quality was associated with the increasing risk of T2DM (odds ratio 2.06,95% CI 1.69-2.52).In multivariate logistic regression,when adjusted for confounding factors,the risk of T2DM was still increased (odds ratio 1.72,95% CI 1.62-1.83).Sleep-related factors (e.g.subjective poor sleep quality,bedtime resistance,short sleep duration,sleep efficiency and sleep disturbance) were correlated with the risk of T2DM (odds ratio was 3.34,1.63,1.10,1.87 and 3.89,respectively).Conclusion Low quality of sleep may be strongly associated with an increased risk of T2DM.
4.Analysis on post-traumatic stress disorder and its relative factors of emergency department nurses after suffering from workplace violence
Ting YU ; Ailing HU ; Ruijuan WEN ; Yanjun ZHANG ; Qiuping LIN ; Yisheng WANG
Chinese Journal of Practical Nursing 2013;(12):41-44
Objective To describe the general condition of workplace violence against emergency department nurses in five hospitals of Guangzhou;to investigate the status of the post-traumatic stress disorder in the emergency department nurses after suffering from workplace violence;to analyze the relative factors of post-traumatic stress disorder.Methods 143 emergency department nurses from 5 hospitals in Guangzhou were investigated by general information questionnaire,workplace violence questionnaire,PCLC and SSRS.The investigation data were analyzed.Results 86.7% of emergency department nurses suffered from workplace violence during the past 1 year;the most popular style was non-physical violence.The emergency department nurses suffered from negative emotional experience,such as grievance,chagrin,low work passion,not focused spirit.The scores of PCL-C of emergency department nurses who had suffered from workplace violence were obviously higher than those who hadn't.21.8% of the emergency department nurses who suffered from workplace violence in the past one year had certain degree of the signs of PTSD,12.1% had obvious signs of PTSD.The influencing factors of PTSD:degree of hurt,objective support and availability of social support.Conclusions The situation of workplace violence which the emergency department nurses were faced with was more and more grave.The emergency department nurses who had suffered from workplace violence were in different degree of PTSD.The more social supports the nurses get,the better mental health status they will possess.
5.The imaging diagnosis of immature teratoma
Ling CHEN ; Wen LIANG ; Xianyue QUAN ; Xiahui TIAN ; Ting LIN ; Feifei CHEN
Journal of Practical Radiology 2014;(5):733-735
Objective To investigate the imaging manifestation of immature teratoma.Methods Imaging features of 9 cases of immature teratoma.confirmed pathologically were retrospective analysed.Results All 9 cases were male,age ranging from 1 to 38 years,mean age 1 9.5 years,AFP increased varying degrees in six cases .(1)3 cases (mean age 25.5 years)located in the anterior mediastinum which CT characteristics included the following features:lesions were projecting to one side,with irregular shape,obvi-ous necrosis,mild enhancement,wrap or oppression the blood vessels,one case with superior vena cava and head arm vein tumor em-boli and mediastinal lymph node metastasis.(2)6 cases (mean age 9.5 years)located in the pineal region and tricorn region,which MR finding were as following :cystic or solid placeholders,tow cases with small calcification or fat,solid part and the capsule wall enhancement significantly,4 cases with nodular enhancement.Conclusion Immature teratoma tends to occur in the middle struc-ture,and appears in children and young adults frequently,necrosis and cystic changes are seen commonly.CT and MR are of high val-ue in diagnosing immature teratoma.
6.Effects of cembrane-type diterpenes on proliferation of PC12 cells and their antagonistic effects on neurotoxicity induced by glutamate.
Dongxiao WANG ; Ping LIU ; Haoyang REN ; Wenhan LIN ; Yaqing YANG ; Xiaofei MA ; Ting WEN ; Hongbo LIAO
Journal of Integrative Medicine 2009;7(11):1061-6
To investigate the effects of cembrane-type diterpenes extracted from Sinularia flexibilis on the proliferation of PC12 cells and their protective effects on PC12 cells exposed to glutamate.
7.Head-neck-coronary one-stop-shop CT angiography:scanning technique and image quality analysis
Xiahui TIAN ; Wen LIANG ; Ling CHEN ; Ting LIN ; Feifei CHEN ; Yongyan JIANG
Journal of Practical Radiology 2015;(1):53-56,90
Objective To explore the scanning technology of head-neck-coronaryone-stop-shopCT angiography using 256-slice iCT and complete image quality analysis.Methods 106 consecutive patients underwent 256-slice iCT head-neck-coronaryone-stop-shop CT angiography.According to the average heart rate,patients were divided into three groups,the 1ow heart rate group with the average heart rate ranged from 40 to 60,medium heart rate group with heart rate from 60 to 80 beats per minute and high heart rate group with heart rate more than 80 beats per minute.The volume rendering (VR),maximum intensity projection (MIP), multi-planar reformation (MPR)and curved planar reconstruction (CPR)were employed for three-dimensional reconstruction after the original image reached to the iCT post-processing workstation.The image quality of head-neck artery and coronary artery were assessed by two senior radiologists individually .Results The image quality scores in the three groups show statistic significance (F=14.886 , P =0.000).The difference between low heart rate group and medium heart rate group show statistic significance (P =0.031).The difference between low heart rate group and high heart rate group was statistical significant (P = 0.026 ).There was no statistic difference between medium heart rate group and high heart group.The excellent rates of coronary artery image quality reached to 100%,96.6%,92.6% in low,medium and high heart rate group respectively.The rates of excellent about head-neck vascular im-age quality in the three groups reached to 100%.Conclusion 256-slice iCT head-neck-coronaryone-stop-shopCT angiography can obtain satisfactory image.The image quality does not decrease in patients with high heat rate.
8.Identification of chemical constituents in Honghua Xiaoyao Tablet and the analysis of efficacy connotation against premenstrual syndrome based on the "disease-syndrome-symptom-formula" association network
Ke-dian CHEN ; Wen-jia CHEN ; Xue-ting LIU ; Na LIN ; Yan-qiong ZHANG
Acta Pharmaceutica Sinica 2024;59(5):1245-1260
The present study identified chemical constituents of Honghua Xiaoyao Tablet (HXT) and explored its biological connotation and characteristics on the premenstrual syndrome (PMS) treatment from the "disease-syndrome-symptom" association network. UHPLC-Q Exactive Orbitrap HRMS technology was applied to analyze the chemical constituents in HXT. According to the composition principles, the compatible herbs of HXT were divided into the Shugan Jieyu group, Huoxue Tiaojing group and Yiqi Jianpi group. The candidate targets of the corresponding prescriptions of HXT efficacy groups were collected from the Pharmmapper database and Integrative Pharmacology-based Research Platform of Traditional Chinese Medicine (TCMIP) v2.0. The gene set related to the clinical symptoms included in Traditional Chinese and Western Medicine diagnosis and treatment standards were obtained from SoFDA, GeneCards, DisGeNET, MalaCards and literature published. The "HXT candidate targets-PMS (liver depression, Qi stagnation, and blood stasis syndrome) genes" network was constructed based on the gene interaction information, and further, the core network targets were screened out by topological characteristics of calculating network, and the functional exploration was carried out based on Kyoto Encyclopedia of Genes and Genomes (KEGG) for exploring the therapeutic advantages in PMS treatment of HXT efficacy groups, which were further verified experimentally
9.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
10.Radiotherapy combined with chemotherapy increases the risk of herpes zoster in patients with gynecological cancers: a nationwide cohort study
Peng-Yi LEE ; Jung-Nien LAI ; Shang-Wen CHEN ; Ying-Chun LIN ; Lu-Ting CHIU ; Yu-Ting WEI
Journal of Gynecologic Oncology 2021;32(2):e13-
Objective:
This study aimed to determine the effect of radiotherapy (RT) on the risk of herpes zoster (HZ) in patients with gynecological cancers via a nationwide population-based study.
Methods:
Based on patient data obtained from the National Health Insurance Research Database, 1928 gynecological cancer patients were identified with 1:1 matching for RT and non-RT cohorts by age, index date, and cancer type. Another cohort consisting of 964 noncancer individuals matched was used as normal control. The incidence of HZ was compared between cancer patients with and without RT. Age, comorbidities, cancer-related surgery and chemotherapy (CT), and cancer type were adjusted as confounders.
Results:
The risk of HZ in cancer patients was higher than that of non-cancer individuals (14.23 versus 8.34 per 1,000 person-years [PY], the adjusted hazard ratio [aHR]=1.38, p=0.044). In the cancer population, the incidence of HZ for the RT and non-RT cohorts was 20.55 versus 10.23 per 1,000 PY, respectively (aHR=1.68, p=0.009). Age >50 years was an independent factor for developing HZ. The 5-year actuarial incidence for patients receiving neither RT nor CT, RT alone, CT alone, and combined modalities was 5.4%, 6.9%, 3.7%, and 9.9%, respectively (p<0.001). In the RT cohort, the risk rose rapidly in the first year, becoming steady thereafter.
Conclusion
This population-based study showed that gynecological cancer patients receiving RT combined with CT had the highest cumulative risk of HZ. Health care professionals should be aware of the potential toxicities.