1.Effect of Danggui Buxuetang on PINK1/Parkin Signaling Pathway of Vascular Dementia Rats
Guifang QI ; Yue JIANG ; Yunxiang TAN ; Nanbu WANG ; Xinghua CHEN ; Ting WAN
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):15-24
ObjectiveTo investigate the potential mechanism of Danggui Buxuetang (DBT) in the treatment of vascular dementia (VAD). MethodsSixty male SD rats were randomly assigned to the sham-operated group, model group, DBT low-, medium-, and high-dose groups, and the donepezil group. Except for the sham-operated group, rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling, DBT was administered at doses of 9.2, 18.4, 36.8 g·kg-1 for the low-, medium-, and high-dose groups, respectively, while the donepezil group received 3 mg·kg-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment, rats underwent the Morris water maze test, novel object recognition test, Nissl staining to observe hippocampal neurons, and immunofluorescence staining to detect the expression of neuronal nuclear protein (NeuN) in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 (PINK1), Parkin, microtubule-associated protein 1 light chain 3Ⅱ (LC3Ⅱ), B-cell lymphoma-2 (Bcl-2), and Bcl-2-associated X protein (Bax). Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22phox and p47phox in hippocampal tissues. The levels of malondialdehyde (MDA), glutathione (GSH), superoxide dismutase (SOD), and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test, escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group, the model group showed significantly prolonged escape latency (P<0.01). Compared with the model group, rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency (P<0.05, P<0.01). The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group (P<0.01), whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group (P<0.05, P<0.01). Compared with the sham-operated group, exploration time of new objects was significantly reduced in the model group (P<0.01). Compared with the model group, exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group (P<0.05, P<0.01), while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group, rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time (P<0.05). Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group, with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group, neuronal density in CA1 and CA3 increased, with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group, the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased(P<0.01), compared with the VAD model group, the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased(P<0.01). Compared with the sham-operated group, the expression of PINK1, Parkin, LC3Ⅱ, and Bax proteins was significantly increased(P<0.01), while the expression of Bcl-2 was significantly decreased in the VAD model group(P<0.01). Compared with the VAD model group, the high-dose DBT group showed significantly decreased expression of PINK1, Parkin, LC3Ⅱ, and Bax proteins(P<0.01)and significantly upregulated Bcl-2 expression(P<0.01). The medium-dose DBT group exhibited significantly reduced expression of Parkin, LC3Ⅱ, and Bax proteins(P<0.05,P<0.01) and significantly increased Bcl-2 expression(P<0.01), while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis, thickened cristae, increased electron density, and the presence of mitochondrial autophagy in the model group. In contrast, hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology, clear cristae, and uniform matrix. Compared with the sham-operated group, total antioxidant capacity, SOD activity, and GSH levels were significantly decreased, while MDA levels were significantly increased in the model group (P<0.01). Compared with the model group, total antioxidant capacity and antioxidant levels (SOD, GSH) increased significantly, and MDA decreased significantly in the medium- and high-dose DBT groups (P<0.01), while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group, mRNA expression of p22phox and p47phox was significantly increased in the model group (P<0.01). Compared with the model group, expression of p22phox and p47phox was significantly decreased in the DBT groups (P<0.05, P<0.01). ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy, thereby improving learning and memory abilities and treating VAD.
2.Qishao Capsules Improve Diabetic Renal Injury in db/db Mice by Inhibiting Podocyte Apoptosis via Regulating Caspase-8 and Caspase-3
Jingwei LIU ; Zhenhua WU ; Bing YANG ; Fengwen YANG ; Miao TAN ; Tingting LI ; Jinchuan TAN
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):126-135
ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease (DKD),and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice (7 mice) were used as the normal group,and db/db mice (35 mice) were randomly divided into a model group,a dapagliflozin group (0.001 g·kg-1·d-1),and low-,medium-,and high-dose groups of Qishao capsules (0.341 3,0.682 5,and 1.365 g·kg-1·d-1,respectively). Drug intervention lasted for 8 consecutive weeks. After sampling,the serum renal function indicators [creatinine(SCr),and urea nitrogen(BUN)],fasting blood glucose (FBG),24 h urinary protein quantification (24 h-UTP), and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine (PASM) and Masson's trichrome (Masson) staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease (Caspase)-3 and B-cell lymphoma 2 (Bcl-2) was performed. Western blot was used to detect the protein expression of Caspase-8,Caspase-7,Caspase-3, and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling (TUNEL) staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1
3.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
4.Comparison of preoperative ocular biometry between Pentacam AXL and IOL Master 700 in cataract patients
Jinfen WEI ; Simin TAN ; Lin DING ; Qiuli ZHANG
International Eye Science 2026;26(1):148-151
AIM: To compare the preoperative ocular biometry between Pentacam AXL and IOL Master 700 in cataract patients.METHODS:Prospective study. A total of 150 patients(150 eyes)with cataracts who were treated in our hospital from May to December 2024 were selected. The IOL Master 700 and Pentacam AXL were preoperatively used to measure axial length(AL), corneal curvature(K1, K2 and Km), anterior chamber depth(ACD), and white-to-white(WTW). The difference and consistency of the results of the two instruments were compared.RESULTS: There was no significant difference between the two instruments in the AL, K1, K2, Km, ACD, and WTW(all P>0.05). The Spearman correlation analysis showed that the two instruments positively correlated with the AL, K1, K2, Km, ACD and WTW of the operated eye(all P<0.001). The Bland-Altman analysis showed that for the Pentacam AXL and IOL Master 700, there were 5/150(3.3%), 7/150(4.7%), 4/150(2.7%), 5/150(3.3%), and 0 points outside the 95%LoA for the AL, K1, K2, Km, ACD, and WTW of the examined eyes, respectively, with all of these values less than 5%, indicating good consistency.CONCLUSION:The AL, K1, K2, Km, ACD and WTW of Pentacam AXL and IOL Master 700 in cataract patients before cataract phacoemulsification combined with IOL implantation show no significant differences, and have good correlation and consistency. The two instruments can be used interchangeably.
5.Effect of Yang-Reinforcing and Blood-Activating Therapy on the Long-Term Prognosis for Dilated Cardio-myopathy Patients with Yang Deficiency and Blood Stasis Syndrome:A Retrospective Cohort Study
Shiyi TAO ; Jun LI ; Lintong YU ; Ji WU ; Yuqing TAN ; Xiao XIA ; Fuyuan ZHANG ; Tiantian XUE ; Xuanchun HUANG
Journal of Traditional Chinese Medicine 2026;67(1):53-59
ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy (DCM) of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group (186 cases) and non-exposure group (185 cases) according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months, and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events (MACE) in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE, and subgroup analysis was performed. Changes in traditional Chinese medicine (TCM) syndrome score, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), left ventricular end-diastolic diameter (LVEDD), and Minnesota Living with Heart Failure Questionnaire (MLHFQ) score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy (before treatment) and 1 year after receiving the therapy (after treatment). ResultsMACE occurred in 31 cases (16.67%) in the exposure group and 47 cases (25.41%) in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group [HR=0.559, 95%CI(0.361,0.895), P=0.014]. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients [HR=0.623, 95%CI(0.396,0.980), P=0.041], and consistent results were observed in different subgroups. Compared with pre-treatment, the exposure group showed decreased TCM syndrome score and MLHFQ score, reduced LVEDD, and increased LVEF and LVFS after treatment (P<0.05); in the non-exposure group, TCM syndrome score decreased, LVEF and LVFS increased, and LVEDD reduced after treatment (P<0.05). After treatment, the exposure group had higher LVEF and LVFS, smaller LVEDD, and lower TCM syndrome score and MLHFQ score compared with the non-exposure group (P<0.05). ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome, meanwhile improving their clinical symptoms, cardiac function, and quality of life.
6.Factors affecting benefit finding among young and middle-aged patients with type 2 diabetes mellitus
WU Chenghui ; PENG Yanhong ; ZHANG Ke ; ZHU Weiye ; DENG Liang ; TAN Lingling ; QU Dandan ; MI Qiuxiang
Journal of Preventive Medicine 2026;38(1):31-35
Objective:
To investigate the current status of benefit finding among young and middle-aged patients with type 2 diabetes mellitus (T2DM) and analyze its influencing factors, so as to provide a reference for improving the level of benefit finding in this population.
Methods:
From November 2022 to May 2023, young and middle-aged patients with T2DM aged 18-59 years hospitalized in the endocrinology departments of 2 tertiary hospitals in Hengyang City, Hunan Province were selected as survey subjects by a convenience sampling method. Basic demographic information was collected using a general questionnaire survey. Benefit finding, resourcefulness, and stigma were evaluated using the Benefit Finding Scale, the Chinese Version of the Resourcefulness Scale, and the Type 2 Diabetes Stigma Assessment Scale, respectively. A multiple linear regression model was used to analyze the influencing factors of benefit finding among young and middle-aged patients with T2DM.
Results:
A total of 305 young and middle-aged patients with T2DM were investigated, including 222 males (72.79%) and 83 females (27.21%). There were 231 cases aged 45-59 years, accounting for 75.74%. The scores for benefit finding, resourcefulness, and stigma were (42.86±6.06), (75.12±11.30), and (41.20±10.10), respectively. Multiple linear regression analysis showed that young and middle-aged patients with T2DM who were male (β′=0.088), aged 18-<45 years (β′=0.083), absence of diabetes complications (β′=0.124), and had higher resourcefulness scores (β′=0.679) had higher levels of benefit finding, while patients with higher stigma scores (β′=-0.097) had lower levels of benefit finding.
Conclusion
The level of benefit finding among young and middle-aged patients with T2DM was moderate, and was related to gender, age, diabetes complications, resourcefulness, and stigma.
7.Jianpi Xiaoai Prescription Ameliorates Chemotherapy Resistance in Colon Cancer by Targeting FGF2 to Inhibit PI3K/Akt Signaling Pathway
Xiaolan JIAN ; Kangwen NING ; Jiaxiang YANG ; Shenglan KOU ; Wanting KUANG ; Ziqi WANG ; Yuqin TAN ; Puhua ZENG ; Lingjuan TAN ; Wei PENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(6):120-130
ObjectiveTo explore the effect and mechanism of Jianpi Xiaoai prescription (JPXA) in ameliorating the 5-fluorouracil (5-FU) resistance of colon cancer. MethodsA HCT116/5-FU resistant cell line was established. Different concentrations (10%, 15%, 20%) of JPXA-containing serum and drug-free serum were used for intervention, and 10% fetal bovine serum (10% FBS), fibroblast growth factor receptor (FGFR) inhibitor (AZD4547), and recombinant fibroblast growth factor 2 (FGF2) were set as the control groups. Sensitive HCT116 cells were used in the FGF2 group, while HCT116/5-FU cells were used in other groups. Drug resistance, the level of FGF2 in the cell culture medium, the mRNA level of FGF2 in cells, and the protein levels of FGF2/FGFR and phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) were determined. The drug-resistant cells were transplanted into the axilla of nude mice to establish a tumor model. The modeled mice were allocated into model, JPXA (15 g·kg-1), 5-FU (0.02 g·kg-1), JPXA+5-FU (15 g·kg-1+0.02 g·kg-1), AZD4547 (0.012 5 g·kg-1), and AZD4547+5-FU (0.012 5 g·kg-1+0.02 g·kg-1) groups. The tumor growth and the protein levels of FGF/FGFR and PI3K/Akt in each group were observed. ResultsThe survival rate of HCT116/5-FU cells decreased in all the JPXA groups with different concentrations. The cell survival rate was decreased most obviously in the 20% JPXA group. The level of FGF2 in the cell culture medium and the mRNA level of FGF2 in cells of each JXPA group decreased, and the decrease was the most significant in the 20% group (P<0.01). HCT116/5-FU cells showed up-regulated protein levels of FGF2 and phosphorylated fibroblast growth factor receptor 1 (p-FGFR1), but down-regulated protein level of FGFR1 (P<0.01). JPXA down-regulated the expression of FGF2 and p-FGFR1 and up-regulated the expression of FGFR1 (P<0.05). In addition, JPXA down-regulated the expression levels of phosphorylated protein kinase B (p-Akt) and phosphorylated mammalian target of rapamycin (p-mTOR), while up-regulating the expression levels of Akt and Bcl-2-asociated death promoter (Bad) (P<0.05). Animal experiments showed that the JPXA combined with 5-FU significantly inhibited the growth of drug-resistant tumors, reduced the protein levels of FGF2, p-FGFR1, phosphorylated phosphatidylinositol-3-kinase (p-PI3K), p-Akt, and p-mTOR, and increased the expression of Bad. It indicated that JPXA can inhibit the FGF2/FGFR1 signaling in colon cancer and regulate PI3K/Akt and downstream signaling pathways. ConclusionJPXA can ameliorate the chemotherapy resistance of colon cancer through down-regulating FGF2 expression and inhibiting the activation of the PI3K/Akt signaling pathway.
8.Herbal Textual Research on Quisqualis Fructus in Famous Classical Formulas
Xiuping WEN ; Shiying CHEN ; Ying TAN ; Guanwen ZHENG ; Huilong XU ; Wen XU ; Chengzi YANG ; Zehao HUANG ; Yu LIN ; Zhilai ZHAN
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(6):225-237
This article systematically analyzed the historical evolution of the origin, scientific name, producing area, quality evaluation, harvesting and processing, and other aspects of Quisqualis Fructus by consulting the ancient materia medica, medical books, prescription books, local literature and combining with the modern literature and standards, summarized and explored the development rules of its medicinal properties and efficacy along with their underlying causes, in order to provide support for the development and utilization of famous classical formulas containing this herb. According to the textual research, Shijunzi was first recorded as Liuqiuzi in Nanfang Caomuzhuang of the Jin dynasty, and the name of Shijunzi was first used in Kaibao Bencao of the Song dynasty, which has been consistently used throughout subsequent dynasties, and there were also aliases such as Junziren, Sijunzi, and Dujilizi. The mainstream source of Quisqualis Fructus used in the past dynasties has been the dried mature fruits of Quisqualis indica, a plant belonging to the family Combretaceae. In modern times, its variety Q. indica var. villosa has also been recorded as the medicinal material of Quisqualis Fructus. In 2007, the Flora of China(English edition) designated Q. indica var. villosa as a synonym of Q. indica. Today, the accepted name of Shijunzi is updated to Combretum indicum. According to ancient herbal records, the producing areas of Quisqualis Fructus were Guangdong, Hong Kong, Macao, Guangxi, Hainan, Sichuan and Fujian, and then gradually expanded to Yunnan, Taiwan, Jiangxi and Guizhou. Since the Song dynasty, two major production regions have gradually emerged in Sichuan, Chongqing and Fujian. Currently, it is primarily cultivated in Chongqing, Guangxi and other areas, with Chongqing yielding the highest output. Since modern times, superior quality has been defined by large size, a purple-black surface, plump grains, and a yellowish-white kernel. According to ancient herbal records, the harvesting period of Quisqualis Fructus was the July and August of the lunar calendar, mostly used raw after shelling or with the shell intact, it underwent processing methods such as cleaning, slicing, mixing, steaming, roasting, stewing, and frying. Currently, the harvesting period is autumn, followed by sun-drying or low-heat drying, with processing methods including cleaning, stir-frying, and stewing. In ancient and modern literature, the records of the properties, functions and indications of Quisqualis Fructus are basically the same, that is, sweet in taste, warm in nature, predominantly non-toxic, belonging to the spleen and stomach meridians. It possesses effects of insecticide, decontamination and invigorating spleen for ascariasis, enterobiasis, abdominal pain due to worm accumulation and infantile malnutrition.The contraindications for use primarily include avoiding consumption by individuals without parasitic infestations, limiting use for those with spleen-stomach deficiency-cold, refraining from drinking hot tea during medication, and avoiding excessive intake. Based on the textual research, it is suggested that the dried mature fruits of Q. indica should be used as the medicinal material for the development of famous classical formulas containing Quisqualis Fructus. Processing methods may be chosen according to prescription requirements, and the raw products is recommended for medicinal use if not specified.
9.Therapeutic Effect and Mechanism of Shentong Zhuyutang Combined with Dilongtang in Treatment of Lumbar Disc Herniation with Qi Stagnation and Blood Stasis Syndrome
Huangsheng TAN ; Yinbo WANG ; Yong HUANG ; Juyi LAI ; Hualong FENG ; Zhiming LAN ; Yuanfei FU ; Yong JIANG ; Shenghua HE
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(1):47-54
ObjectiveTo observe the clinical efficacy of Shentong Zhuyutang combined with Dilongtang in the treatment of lumbar disc herniation (LDH) with Qi stagnation and blood stasis syndrome, and its effect on nucleus pulposus reabsorption and immune-inflammatory factors, exploring its therapeutic mechanism from the perspective of reabsorption. MethodsA total of 120 patients with LDH from the Fourth Clinical Medical College of Guangzhou University of Chinese Medicine, treated between June 2020 and January 2023, were randomly divided into the control group (52 cases, with 8 dropouts) and the observation group (49 cases, with 11 dropouts) according to a random number table. The control group received routine treatment, while the observation group was treated with Shentong Zhuyutang combined with Dilongtang in addition to routine treatment. Visual Analogue Scale (VAS), Oswestry Disability Index (ODI), Japanese Orthopaedic Association (JOA) score, and traditional Chinese medicine (TCM) syndrome score were measured before treatment and after 3 courses of treatment. Venous blood samples were collected for the determination of serological indexes. MR examination was performed during the 6-month follow-up to calculate the absorption rate. ResultsAfter treatment, both groups showed significant reductions in VAS, ODI, TCM syndrome score, serum tumor necrosis factor (TNF)-α, matrix metalloproteinase (MMP)-9, and vascular endothelial growth factor (VEGF) levels, and a significant increase in JOA score compared with pre-treatment values (P<0.05). Compared with the control group, the observation group showed significantly lower VAS, ODI, TCM syndrome score, serum TNF-α, MMP-9, and VEGF levels, and a significantly higher JOA score (P<0.05). The proportion of nucleus pulposus reabsorption in the observation group was 57.14% (28/49), significantly higher than 21.15% (11/52) in the control group (χ2=6.161, P<0.05). ConclusionShentong Zhuyutang combined with Dilongtang can effectively relieve pain, improve lumbar function, and alleviate TCM clinical symptoms in LDH patients with Qi stagnation and blood stasis syndrome. Imaging findings suggest that the treatment promotes the reabsorption of nucleus pulposus protrusion, while laboratory testing shows reduced serum levels of TNF-α, MMP-9, and VEGF, which contribute to the rehabilitation of patients.
10.Principles, technical specifications, and clinical application of lung watershed topography map 2.0: A thoracic surgery expert consensus (2024 version)
Wenzhao ZHONG ; Fan YANG ; Jian HU ; Fengwei TAN ; Xuening YANG ; Qiang PU ; Wei JIANG ; Deping ZHAO ; Hecheng LI ; Xiaolong YAN ; Lijie TAN ; Junqiang FAN ; Guibin QIAO ; Qiang NIE ; Mingqiang KANG ; Weibing WU ; Hao ZHANG ; Zhigang LI ; Zihao CHEN ; Shugeng GAO ; Yilong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):141-152
With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.


Result Analysis
Print
Save
E-mail