No abstract available.
Breast

The operative treatment of orbital blowout fracture involves restoration of intra-orbital soft tissue and bony structural integrity. In extensive blowout fracture, postoperative edema and subsequent increase of intraoribital pressure may sometimes lead to displace the implant. To prevent postperative displacement of the implant, we tried reinforcing the implant using a buttress consisting of micro-titanium mesh and titanium mesh in 13 cases of extensive orbital blowout fracture, including medical wall fracture (6), inferior wall fracture (5) and inferomedial wall fracture (2). A small thin titanium buttress was inserted beneath the implant at the point where intraorbital pressure was involved maximally. It was usually placed superoinferiorly in a medial wall fracture wall fracture, mediplaterally along th posterior ridge of bony defect in an inferior wall fracture, and anteroposteriorly in an inferomedial wall fracture. No evidence of implant displacement after operation was noted in any cases and this was confirmed by postoperative computed tomographic scan. Also, any complication by a titanium buttress did not occur. Orbital implant reinforcement using a titanium buttress may be an available technique for preventing implant displacement in reconstruction of extensive orbital blowout frature.
Edema ; Orbit* ; Orbital Implants ; Titanium*

Raynaud's phenomenon manifests as triphasic color change episodes of blanching, cyanosis, and reddening of the digits, induced by exposure to low temperature or emotional stress. It is a relatively common disorder, estimated to affect 5-10% of the general population and 20-30% of otherwise healthy women. Most cases of primary Raynaud's phenomenon also called Raynaud's disease, are mild and self-limited. Secondary Raynaud's phenomenon presents as a secondary manifestation of an underlying disease and are complicated by ulcerations and tissue necrosis. From March 1996 to August 1998, we experienced 4 patients with Raynaud's phenomenon. Two patients were diagnosed Raynaud's disease and the other two were secondary. Raynaud's disease responded to drug therapy and sympatetic ganglion block. Secondary Raynaud's syndrome was treated with vein graft and free tissue transfer. During postoperative follow-up of 33-49 months, both severity and symptomatic intervals were improved.
Cyanosis ; Drug Therapy ; Female ; Follow-Up Studies ; Ganglion Cysts ; Humans ; Necrosis ; Raynaud Disease ; Stress, Psychological ; Transplants ; Ulcer ; Veins

With the development of antenatal diagnostic tools such as ultrasonography, some congenital anomalies or diseases can be detected in early fetal life. Routine serial antenatal check-ups have made it possible to predict the prognosis of these problems, and a few life-threatening single anatomic malformations have been treated by open fetal surgery. The experience of fetal surgery revealed that the human fetus appears to heal without any scarring. In contrast to adult animals, the response to tissue injury in the fetus is conspiciously devoid of acute inflammation. Indeed, the absence of neutrophils is perhaps the most consistent observation in fetal wounds and seems to be followed by absent or scanty fibroblast infiltration, which results in healing with sparse and well organized collagen deposition. Actually, the amount and quality of the collagen deposition were decided by the fibroblasts which infiltrated the wound. It is well known that fetal wounds have sparse collagen deposition, however, the mechanisms are still unclear. This study was designed to evaluate the role of fibroblast activity in the differences of the scar formation between the fetus and neonate. Fibroblast activity such as the cell growth rate, the amount of collagen synthesis and the synthesized collagen types of fetus(IUP 18-22 weeks) was compared with that of neonate. The amount of collagen synthesis was measured by H-proline uptake and the amount of collagen type III was measured by Western blot using antihuman procollagen type III. The cell growth rate as determined by cell proliferation from the initial cell count of 5x10(5) to cell confluence was 3.6 x 10(6) in the fetal fibroblasts compared to 2.5x10(6) in neonatal fibroblasts. Fetal fibroblast synthesize 16.9 x 10(4) cpm of collagen and neonatal fibroblasts synthesize 2.7 x 10(4) cpm of collagen. The synthesized amount of type III collagen was 2.1x10(4) ug/ml, and 1.5x10(4) ug/ml by fetal and neonatal fibroblasts, respectively. In conclusion, fetal fibroblasts grow faster and synthesize a smaller amount of collagen, but produce more type III collagen than neonatal fibroblasts.
Adult* ; Animals ; Blotting, Western ; Cell Count ; Cell Proliferation ; Cicatrix ; Collagen Type III ; Collagen* ; Fetus* ; Fibroblasts* ; Humans ; Infant, Newborn ; Inflammation ; Neutrophils ; Prognosis ; Ultrasonography ; Wounds and Injuries

BACKGROUND: A number of factors can cause dark circles around the eyes including excessive pigmentation, thin and translucent lower eyelid skin overlying the orbicularis oculi muscle, and shadowing due to skin laxity and tear trough. Autologous fat graft is an effective method for the treatment of lower lid dark circles, but irregularities caused by leaving visible lumps of the fat can occur. Tonnard et al. suggested 'nanofat' grafting and introduced its characteristics and clinical applications. The authors used their nanofat grafting to correct lower eyelid dark circles. METHODS: Nanofat grafting was performed in 19 patients for dark lower eyelids. The grafts were injected into subdermal layer using blunt cannula. Microfat grafting with nasojugal fold was performed to all the patients. Among them, 18 patients received transconjunctival fat removal at the same time. RESULTS: All the patients showed much improvement from preoperative dark coloration. There were no visible lumps of fat, contour irregularities, or fat necrosis. Postoperative edema and ecchymosis were minimal. CONCLUSIONS: Nanofat grafting methods provide a good alternative for correcting dark circles by augmenting thin skin with lower complications. This simple, cost effective procedure is suitable for correction of dark circles and various skin rejuvenation purposes.
Catheters ; Ecchymosis ; Edema ; Eyelids* ; Fat Necrosis ; Humans ; Hyperpigmentation ; Pigmentation ; Rejuvenation ; Shadowing (Histology) ; Skin* ; Transplantation ; Transplants*

No abstract available.
Plastics* ; Surgery, Plastic*

No abstract available.
Breast*

Split-lid excision with or without levator hitching has been experienced in the correction of mild to moderate blepharoptosis in 18 lids in 15 patients. 12 patients were unilateral and 3 patients were bilateral. Split level resection was performed in cases of levator function of more than 7mm, whereas 5-6mm of levator function was addressed with additional levator hitching as described by Mustarde. In patients with a moderate degree of ptosis, the authors split the lid vertically into two layers and resected a horizontal block of full-thickness upper eyelid at two different levels. Most of the tarsal plate with its overlying conjunctiva was removed from one layer and, at a higher site, a corresponding amount of skin and orbicularis from the other. In patients with more severe degree of ptosis, the authors achieved levator complex shortening by folding some of the levator complex upward on itself after split-lid excision procedure. Undercorrection was seen in 4 lids, and lid lag on downward gaze was observed in 6 lids. In contrast, overcorrection or significant lagophthalmos at primary gaze could not be seen. Except for lid edema which abated during the ensuing several months, troublesome complication was not observed. It can be safely said from this that split-lid excision technique with or without levator hitching is a reasonable option in the correction of mild to moderate forms of blepharoptosis.
Blepharoptosis ; Conjunctiva ; Edema ; Eyelids ; Humans ; Mustard Plant ; Skin

The mechanism underlying cranial suture fusion remains yet unknown. An in vitro tissue culture model of cranial sutures permits exclusion of biomechanical factors that may affect the fusion and patency of cranial sutures. The posterior frontal cranial sutures were placed in a tissue culture model. The experimental groups consisted of control group, and two groups cultured in TGF-beta enriched medium with and without the underlying dura mater. Results showed in vitro fusion of the explanted cranial sutures in vitro 39 days postnatal. Cranial suture fusion was accelerated in the TGF- beta < treated group with intact dura mater(postnatal 32days). Cranial suture fusion in the TGF- beta treated dura denuded group occurred, though in a delayed manner compared to the dura intact group.
Animals ; Cranial Sutures ; Dura Mater ; Mice* ; Sutures* ; Transforming Growth Factor beta

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels