1.A time-stratified case-crossover study on association between short-term exposure to air pollutants and myocardial infarction mortality in Shenzhen
Ziyang ZOU ; Ruijun XU ; Ziquan LYU ; Zhen ZHANG ; Jiaxin CHEN ; Meilin LI ; Xiaoqian GUO ; Suli HUANG
Journal of Environmental and Occupational Medicine 2025;42(5):586-593
Background Air pollution remains a critical public health issue, with persistent exposure to air pollutants continuing to pose significant health risks. Currently, research investigating the association between air pollution and myocardial infarction mortality in Shenzhen remains inadequate. Objective To quantitatively assess the association between air pollutants and myocardial infarction mortality in residents. Methods Based on the mortality surveillance system of Shenzhen Center for Disease Control and Prevention, we conducted a time-stratified case-crossover study of
2.Dynamics of eosinophil infiltration and microglia activation in brain tissues of mice infected with Angiostrongylus cantonensis
Fanna WEI ; Renjie ZHANG ; Yahong HU ; Xiaoyu QIN ; Yunhai GUO ; Xiaojin MO ; Yan LU ; Jiahui SUN ; Yan ZHOU ; Jiatian GUO ; Peng SONG ; Yanhong CHU ; Bin XU ; Ting ZHANG ; Yuchun CAI ; Muxin CHEN
Chinese Journal of Schistosomiasis Control 2025;37(2):163-175
Objective To investigate the changes in eosinophil counts and the activation of microglial cells in the brain tissues of mice at different stages of Angiostrongylus cantonensis infection, and to examine the role of microglia in regulating the progression of angiostrongyliasis and unravel the possible molecular mechanisms. Methods Fifty BALB/c mice were randomly divided into the control group and the 7-d, 14-d, 21-day and 25-d infection groups, of 10 mice in each group. All mice in infection groups were infected with 30 stage III A. cantonensis larvae by gavage, and animals in the control group was given an equal amount of physiological saline. Five mice were collected from each of infection groups on days 7, 14, 21 d and 25 d post-infection, and 5 mice were collected from the control group on the day of oral gavage. The general and focal functional impairment was scored using the Clark scoring method to assess the degree of mouse neurological impairment. Five mice from each of infection groups were sacrificed on days 7, 14, 21 d and 25 d post-infection, and 5 mice from the control group were sacrificed on the day of oral gavage. Mouse brain tissues were sampled, and the pathological changes of brain tissues were dynamically observed using hematoxylin and eosin (HE) staining. Immunofluorescence staining with eosinophilic cationic protein (ECP) and ionized calcium binding adaptor molecule 1 (Iba1) was used to assess the degree of eosinophil infiltration and the counts of microglial cells in mouse brain tissues in each group, and the morphological parameters of microglial cells (skeleton analysis and fractal analysis) were quantified by using Image J software to determine the morphological changes of microglial cells. In addition, the expression of M1 microglia markers Fcγ receptor III (Fcgr3), Fcγ receptor IIb (Fcgr2b) and CD86 antigen (Cd86), M2 microglia markers Arginase 1 (Arg1), macrophage mannose receptor C-type 1 (Mrc1), chitinase-like 3 (Chil3), and phagocytosis genes myeloid cell triggering receptor expressed on myeloid cells 2 (Trem2), CD68 antigen (Cd68), and apolipoprotein E (Apoe) was quantified using real-time quantitative reverse transcription PCR (RT-qPCR) assay in the mouse cerebral cortex of mice post-infection. Results A large number of A. cantonensis larvae were seen on the mouse meninges surface post-infection, and many neuronal nuclei were crumpled and deeply stained, with a large number of bleeding points in the meninges. The median Clark scores of mouse general functional impairment were 0 (interquartile range, 0), 0 (interquartile range, 0.5), 6 (interquartile range, 1.0), 14 (interquartile range, 8.5) points and 20 (interquartile range, 9.0) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.45, P < 0.01), and the median Clark scores of mouse focal functional impairment were 0 (interquartile range, 0), 2 (interquartile range, 2.5), 7 (interquartile range, 3.0), 18 (interquartile range, 5.0) points and 25 (interquartile range, 6.5) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.72, P < 0.01). The mean scores of mice general and focal functional impairment were all higher in the infection groups than in the control group (all P values < 0.05). Immunofluorescence staining showed a significant difference in the eosinophil counts in mouse brain tissues among the five groups (F = 40.05, P < 0.000 1), and the eosinophil counts were significantly higher in mouse brain tissues in the 14-d (3.08 ± 0.78) and 21-d infection groups (5.97 ± 1.37) than in the control group (1.00 ± 0.28) (both P values < 0.05). Semi-quantitative analysis of microglia immunofluorescence showed a significant difference in the counts of microglial cells among the five groups (F = 17.66, P < 0.000 1), and higher Iba1 levels were detected in mouse brain tissues in 14-d (5.75 ± 1.28), 21-d (6.23 ± 1.89) and 25-d infection groups (3.70 ± 1.30) than in the control group (1.00 ± 0.30) (all P values < 0.05). Skeleton and fractal analyses showed that the branch length [(162.04 ± 34.10) μm vs. (395.37 ± 64.11) μm; t = 5.566, P < 0.05] and fractal dimension of microglial cells (1.30 ± 0.01 vs. 1.41 ± 0.03; t = 5.266, P < 0.05) were reduced in mouse brain tissues in the 21-d infection group relative to the control group. In addition, there were significant differences among the 5 groups in terms of M1 and M2 microglia markers Fcgr3 (F = 48.34, P < 0.05), Fcgr2b (F = 55.46, P < 0.05), Cd86 (F = 24.44, P < 0.05), Arg1 (F = 31.18, P < 0.05), Mrc1 (F = 15.42, P < 0.05) and Chil3 (F = 24.41, P < 0.05), as well as phagocytosis markers Trem2 (F = 21.19, P < 0.05), Cd68 (F = 43.95, P < 0.05) and Apoe (F = 7.12, P < 0.05) in mice brain tissues. Conclusions A. cantonensis infections may induce severe pathological injuries in mouse brain tissues that are characterized by massive eosinophil infiltration and persistent activation of microglia cells, thereby resulting in progressive deterioration of neurological functions.
3.Therapeutic effect and mechanism by which Trichosanthis Fructus-Allii Macrostemonis Bulbus regulates gut microbiota in a rat model of coronary heart disease
Guanghan SUN ; Zhencong XIE ; Mi SUN ; Yang XU ; Dong GUO
Chinese Journal of Tissue Engineering Research 2025;29(5):917-927
BACKGROUND:A network-based pharmacological approach has identified multifunctional effects of the main bioactive compounds in the Trichosanthis Fructus-Allii Macrostemonis Bulbus on coronary heart disease;however,the mechanism of its therapeutic effect on coronary heart disease has not been fully elucidated. OBJECTIVE:To investigate the role and mechanism of Trichosanthis Fructus-Allii Macrostemonis Bulbus in improving coronary heart disease by regulating the composition of gut microbiota. METHODS:Forty Sprague-Dawley rats were randomly divided into four groups:blank control group(n=10),model group(n=10),positive drug group(n=10),and medicine pair group(n=10).A rat model of coronary heart disease was established by continuous gastric perfusion of fat emulsion and injection of pituitrin.After modeling,rats in the model group were gavaged with distilled water(10 mL/kg)for control,rats in the positive drug group were gavaged with simvastatin 4 mg/kg per day,and rats in the medicine pair group were gavaged with Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs 7.56 g/kg per day.All interventions lasted for 14 days.Electrocardiograms and myocardial pathology were observed,and blood lipid levels were measured.The structure of gut microbiota was analyzed using 16S rDNA sequencing technology. RESULTS AND CONCLUSION:Electrocardiogram results showed ST segment elevation in the model group.There were no significant abnormalities in the electrocardiograms of the positive drug group and medicine pair group.Compared with the blank control group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly higher in the model group(P<0.05).Compared with the model group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly lower in the positive drug group and medicine pair group(P<0.05).Compared with the blank control group,focal myocardial cell necrosis was observed in the model group,while partial myocardial cell disarray was observed in the positive drug group and medicine pair group.Compared with the blank control group,the Ace,Shannon,and Chao indices were increased(P<0.05)and the Simpson index was decreased(P<0.05)in the model group,positive drug group and medicine pair group.Compared with the model group,the Ace and Chao indices were decreased(P<0.05),while the Shannon index showed no significant difference(P>0.05)and the Simpson index was also decreased(P<0.05)in the positive drug group and medicine pair group.Compared with the blank control group,the relative abundances of Desulfovibrionia,Muribaculaceae_norank,etc.were increased in the model group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.Compared with the model group,the relative abundances of WPS-2_norank,Muribaculaceae_norank,etc.were increased in the medicine pair group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased;the relative abundances of Desulfobacterota,[Eubacterium]_coprostanoligenes_group_norank,etc.were increased in the positive drug group,while those of Firmicutes,Muribaculaceae_norank,etc.were decreased.Compared with the positive drug group,the relative abundances of Desulfobacterota,Bacteroides,etc.were increased in the medicine pair group,while those of Firmicutes,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.The LEfSe results showed that the medicine pair group had the highest microbial enrichment,followed by the blank control group and positive drug group,with the model group having the lowest microbial enrichment.To conclude,Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs can improve the development of coronary heart disease by regulating gut microbiota composition,providing new insights for further research and development of Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs.
4.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
5.Innovations and Challenges in Molecular Probe-Based Precision Theranostics for Genitourinary System Tumors
Mingwei SUN ; Pengyu GUO ; Wanhai XU
Cancer Research on Prevention and Treatment 2025;52(10):811-817
Genitourinary system tumors, as a major clinical challenge posing a serious threat to human health, urgently require breakthroughs in the construction of a precision diagnosis and treatment system. The innovative application of molecular imaging technologies, particularly the development of novel molecular probes, is revolutionizing the diagnostic and therapeutic paradigms for urinary tumors. The application of novel molecular probes in the early diagnosis and staging of genitourinary tumors, the role of multimodal molecular imaging probes in guiding precision surgery/radiotherapy, and the clinical translation challenges and strategies for theranostic-integrated probes are systematically reviewed in this article to provide valuable insights and references for related research and clinical practice.
6.Percutaneous coronary intervention vs . medical therapy in patients on dialysis with coronary artery disease in China.
Enmin XIE ; Yaxin WU ; Zixiang YE ; Yong HE ; Hesong ZENG ; Jianfang LUO ; Mulei CHEN ; Wenyue PANG ; Yanmin XU ; Chuanyu GAO ; Xiaogang GUO ; Lin CAI ; Qingwei JI ; Yining YANG ; Di WU ; Yiqiang YUAN ; Jing WAN ; Yuliang MA ; Jun ZHANG ; Zhimin DU ; Qing YANG ; Jinsong CHENG ; Chunhua DING ; Xiang MA ; Chunlin YIN ; Zeyuan FAN ; Qiang TANG ; Yue LI ; Lihua SUN ; Chengzhi LU ; Jufang CHI ; Zhuhua YAO ; Yanxiang GAO ; Changan YU ; Jingyi REN ; Jingang ZHENG
Chinese Medical Journal 2025;138(3):301-310
BACKGROUND:
The available evidence regarding the benefits of percutaneous coronary intervention (PCI) on patients receiving dialysis with coronary artery disease (CAD) is limited and inconsistent. This study aimed to evaluate the association between PCI and clinical outcomes as compared with medical therapy alone in patients undergoing dialysis with CAD in China.
METHODS:
This multicenter, retrospective study was conducted in 30 tertiary medical centers across 12 provinces in China from January 2015 to June 2021 to include patients on dialysis with CAD. The primary outcome was major adverse cardiovascular events (MACE), defined as a composite of cardiovascular death, non-fatal myocardial infarction, and non-fatal stroke. Secondary outcomes included all-cause death, the individual components of MACE, and Bleeding Academic Research Consortium criteria types 2, 3, or 5 bleeding. Multivariable Cox proportional hazard models were used to assess the association between PCI and outcomes. Inverse probability of treatment weighting (IPTW) and propensity score matching (PSM) were performed to account for potential between-group differences.
RESULTS:
Of the 1146 patients on dialysis with significant CAD, 821 (71.6%) underwent PCI. After a median follow-up of 23.0 months, PCI was associated with a 43.0% significantly lower risk for MACE (33.9% [ n = 278] vs . 43.7% [ n = 142]; adjusted hazards ratio 0.57, 95% confidence interval 0.45-0.71), along with a slightly increased risk for bleeding outcomes that did not reach statistical significance (11.1% vs . 8.3%; adjusted hazards ratio 1.31, 95% confidence interval, 0.82-2.11). Furthermore, PCI was associated with a significant reduction in all-cause and cardiovascular mortalities. Subgroup analysis did not modify the association of PCI with patient outcomes. These primary findings were consistent across IPTW, PSM, and competing risk analyses.
CONCLUSION
This study indicated that PCI in patients on dialysis with CAD was significantly associated with lower MACE and mortality when comparing with those with medical therapy alone, albeit with a slightly increased risk for bleeding events that did not reach statistical significance.
Humans
;
Percutaneous Coronary Intervention/methods*
;
Male
;
Female
;
Coronary Artery Disease/drug therapy*
;
Retrospective Studies
;
Renal Dialysis/methods*
;
Middle Aged
;
Aged
;
China
;
Proportional Hazards Models
;
Treatment Outcome
7.Essential tremor plus affects disease prognosis: A longitudinal study.
Runcheng HE ; Mingqiang LI ; Xun ZHOU ; Lanqing LIU ; Zhenhua LIU ; Qian XU ; Jifeng GUO ; Xinxiang YAN ; Chunyu WANG ; Hainan ZHANG ; Irene X Y WU ; Beisha TANG ; Sheng ZENG ; Qiying SUN
Chinese Medical Journal 2025;138(1):117-119
8.Current status of generalized pustular psoriasis: Findings from a multicenter hospital-based survey of 127 Chinese patients.
Haimeng WANG ; Jiaming XU ; Xiaoling YU ; Siyu HAO ; Xueqin CHEN ; Bin PENG ; Xiaona LI ; Ping WANG ; Chaoyang MIAO ; Jinzhu GUO ; Qingjie HU ; Zhonglan SU ; Sheng WANG ; Chen YU ; Qingmiao SUN ; Minkuo ZHANG ; Bin YANG ; Yuzhen LI ; Zhiqiang SONG ; Songmei GENG ; Aijun CHEN ; Zigang XU ; Chunlei ZHANG ; Qianjin LU ; Yan LU ; Xian JIANG ; Gang WANG ; Hong FANG ; Qing SUN ; Jie LIU ; Hongzhong JIN
Chinese Medical Journal 2025;138(8):953-961
BACKGROUND:
Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited.
METHODS:
This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed.
RESULTS:
Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P = 0.021) and transitioning to plaque psoriasis ( P = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP.
CONCLUSIONS
The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans
;
Male
;
Female
;
Psoriasis/pathology*
;
Adult
;
Cross-Sectional Studies
;
Adolescent
;
Child
;
Young Adult
;
Quality of Life
;
Middle Aged
;
China/epidemiology*
;
Recurrence
;
Risk Factors
;
Surveys and Questionnaires
;
East Asian People
10.Angiogenesis, signaling pathways, and animal models.
Lasse JENSEN ; Ziheng GUO ; Xiaoting SUN ; Xu JING ; Yunlong YANG ; Yihai CAO
Chinese Medical Journal 2025;138(10):1153-1162
The vasculature plays a critical role in homeostasis and health as well as in the development and progression of a wide range of diseases, including cancer, cardiovascular diseases, metabolic diseases (and their complications), chronic inflammatory diseases, ophthalmic diseases, and neurodegenerative diseases. As such, the growth of the vasculature mediates normal development and physiology, as well as disease, when pathologically induced vessels are morphologically and functionally altered owing to an imbalance of angiogenesis-stimulating and angiogenesis-inhibiting factors. This review offers an overview of the angiogenic process and discusses recent findings that provide additional interesting nuances to this process, including the roles of intussusception and angiovasculogenesis, which may hold promise for future therapeutic interventions. In addition, we review the methodology, including those of in vitro and in vivo assays, which has helped build the vast amount of knowledge on angiogenesis available today and identify important remaining knowledge gaps that should be bridged through future research.
Animals
;
Signal Transduction/physiology*
;
Humans
;
Neovascularization, Pathologic/physiopathology*
;
Neovascularization, Physiologic/physiology*
;
Models, Animal
;
Angiogenesis

Result Analysis
Print
Save
E-mail