The spinal injuries were classified into bursting fracture, fracture-dislocation, seat-belt injury, compression fracture according to the three column theory by Denis. The bursting fracture and fracture-dislocation required the most careful planning. So, myelography, computerized tomography enabled us to diagnose the spinal fracture including retropulsed bony fragment into the spinal canal. There was much controversy as to appropriate treatment af unstable thoraco-lumbar fractures. The frequent surgical treatment of thoraco-lumbar spinal fractures was still posterior spinal instrumentation including Harrington rod system. Since 1964, the use of anterior spinal instrumentation had been started by Dwyer, Dunn, Kostrik, Slot, and Zielke used anterior spinal instrumentation in unstable thoraco-lumbar spinal fractures, but not popular. This study suggested the experience to accomplish the decompression of the neural elements and stabilization of the spine by using Kandea device in unstable thoraco-lumbar spinal fractures. 12 patients treated with this Kaneda device in unstable thoraco-lumbar spinal fractures were analyzed from Dec. 1988 to May, 1989 at the Department of Orthopaedic Surgery, Ewha Womans University Hospital. We obtained the following conclusions. The results were as follows. 1. The common injury mechanism was falling down in 5 cases, the frequent injury site was 1st lumbar vertebra. 2. According to Denis classification, the bursting fractures were in 8 cases(68% ), the fracture-dislocations were in 4 cases(33%). 3. The average preoperative kyphotic angulation was 24.5 degrees(range 8 to 45) and postoperative angulation was 5 degrees(range 2 to 15), the correction rate was 79.6% and correction degree was average 19.5 degrees. 4. The advantages were the fixation of one level above and below the injury site, sufficient neural decompression, firm spinal stabilization, early mobilization with a brace and elimination of the 2nd posterior procedure. 5. The fixation of vertebral plate was difficult due to the invariable size of vertebral plates, especially, in upper thoracic spinal fracture and children's fracture.
Accidental Falls ; Braces ; Classification ; Decompression ; Early Ambulation ; Female ; Fractures, Compression ; Humans ; Myelography ; Spinal Canal ; Spinal Fractures ; Spinal Injuries ; Spine

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels

Pseudomembranous colitis, although uncommon, is an important complication of antibiotics that is related to a variety of deleterious effects on the gastrointestinal tract. Rifampicin is one of the 1st line agents in the treatment of tuberculosis and a large number of patients are exposed to its potential adverse effects. We report upon a patient that had diarrhea due to pseudomembranous colitis after receiving antitubeculous medication, and which was probably caused by rifampicin. A 77-year-old man was admitted with diarrhea of three weeks duration. One month previously, he suffered from left pleuritic chest pain and left pleural effusion was noticed at chest X-ray. One week prior to the onset of diarrhea, he was started on empirically isoniazid, rifampicin, ethambutol and pyrazynamide as antituberculous medication. On admission, he complained of diarrhea, left pleuritic chest pain, dyspnea and sputum. On physical examination, breathing sound was decreased in the left lower lung field and bowel sound increased. Pleural biopsy revealed chronic granulomatous infalmmation, which was compatible with tuberculosis. Sigmoidoscopy showed whitish to yellowish pseudomembrane with intervening normal mucosa, and his stool was positive for C.difficle toxin. He was diagnosed as pseudomembranous colitis and treated with oral metronidazole and vancomycin. The diarrhea did not recur after reinstitution of the anti-tuberculous medication without rifampicin. In patients with severe diarrhea receining anti-tuberculous medication, rifampicin induced pseudomembranous colitis should be excluded.
Aged ; Anti-Bacterial Agents ; Biopsy ; Chest Pain ; Clostridium difficile ; Diarrhea ; Dyspnea ; Enterocolitis, Pseudomembranous* ; Ethambutol ; Gastrointestinal Tract ; Humans ; Isoniazid ; Lung ; Metronidazole ; Mucous Membrane ; Physical Examination ; Pleural Effusion ; Respiratory Sounds ; Rifampin* ; Sigmoidoscopy ; Sputum ; Thorax ; Tuberculosis ; Vancomycin

BACKGROUND: Diffuse alveolar hemorrhage (DAH) is rare but often fatal. To determine the clinical manifestations of DAH, its etiology, clinical course and prognosis were studied. METHODS: A retrospective analysis was performed in 21 patients that were diagnosed as DAH. Diagnosis of DAH was based on the presence of the "classical triad" of hemoptysis, anemia, and rapidly progressive infiltrates on chest X-ray and a finding of bronchoalveloar lavage or lung biopsy. RESULTS: Thirteen patients (61.9%) had collagen vascular diseases (CVDs) as underlying disease and 10 patients had systemic lupus erythematosus. Females were more prevalent in CVD than in non-collagen vascular disease (NCVD). Otherwise, there were no significant differences between the two groups in terms of clinical manifestations. Dyspnea (95.2%), cough (76.2%), hemoptysis (61.9%), and fever (33.0%) were frequent symptoms. The initial creatinine level was higher in CVD than in NCVD (3.27±3.15 mg/dl vs. 1.19±0.94 md/dl, p=0.030). The corresponding drop in hemoglobin level was 2.69±1.26 g/dl. Maximal drop in hemoglobin preceded the progression of infiltrates on the chest radiograph by 1.38±4.22 days. The mortality rate was higher in the patients with NCVD than in those with CVD (50.0% vs. 23.1%). CONCLUSION: The DAH can occur not only in patients with CVD but also in those with NCVD. Higher creatinine level CVD in patients is associated with renal involvement in conjunction with DAH. The maximal drop in hemoglobin preceeding the progression of infiltrates on the chest radiograph suggests that the drop in hemoglobin is important for diagnosing DAH.
Anemia ; Biopsy ; Collagen ; Cough ; Creatinine ; Diagnosis ; Dyspnea ; Female ; Fever ; Hemoptysis ; Hemorrhage* ; Humans ; Lung ; Lupus Erythematosus, Systemic ; Mortality ; Prognosis ; Radiography, Thoracic ; Retrospective Studies* ; Therapeutic Irrigation ; Thorax ; Vascular Diseases

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75:1 and 1.82:1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). CONCLUSION: Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.
Child ; Child, Preschool ; DNA ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Homozygote ; Humans ; Infant ; Introns ; Male ; Neurology ; Polymorphism, Single Nucleotide* ; Seizures, Febrile ; Sodium Channels

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75:1 and 1.82:1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). CONCLUSION: Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.
Child ; Child, Preschool ; DNA ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Homozygote ; Humans ; Infant ; Introns ; Male ; Neurology ; Polymorphism, Single Nucleotide* ; Seizures, Febrile ; Sodium Channels

BACKGROUND: Aspergillosis infection is associated with high morbidity and mortality in liver transplant recipients. This study investigated the prognosis of liver transplant recipients with a pre-operative treatment for paranasal aspergillosis. METHODS: We collected data from 979 cases of patients who underwent liver transplants at the Samsung Medical Center from May 1996 to Feburary 2010. RESULTS: Eight patients were diagnosed with paranasal aspergillosis after functional endoscopic sinus surgery (FESS), before liver transplantation. In these 8 patients, 7 (87.5%) were male, with a mean age of 55 years. All patients had a hepatitis B virus infection, and 6 patients had hepatocellular carcinoma. The mean days from FESS to liver transplantation was 31 (range, 12~47 days) and anti-fungal agents were not used during these periods. All 8 patients were free from a recurrence of aspergillosis after liver transplantation. CONCLUSIONS: Surgical treatment for paranasal aspergillosis in patients prior to liver transplantation does not induce aspergillosis infection after transplantation.
Aspergillosis ; Carcinoma, Hepatocellular ; Hepatitis B virus ; Humans ; Liver ; Liver Transplantation ; Male ; Prognosis ; Recurrence ; Transplants

BACKGROUND: Aspergillosis infection is associated with high morbidity and mortality in liver transplant recipients. This study investigated the prognosis of liver transplant recipients with a pre-operative treatment for paranasal aspergillosis. METHODS: We collected data from 979 cases of patients who underwent liver transplants at the Samsung Medical Center from May 1996 to Feburary 2010. RESULTS: Eight patients were diagnosed with paranasal aspergillosis after functional endoscopic sinus surgery (FESS), before liver transplantation. In these 8 patients, 7 (87.5%) were male, with a mean age of 55 years. All patients had a hepatitis B virus infection, and 6 patients had hepatocellular carcinoma. The mean days from FESS to liver transplantation was 31 (range, 12~47 days) and anti-fungal agents were not used during these periods. All 8 patients were free from a recurrence of aspergillosis after liver transplantation. CONCLUSIONS: Surgical treatment for paranasal aspergillosis in patients prior to liver transplantation does not induce aspergillosis infection after transplantation.
Aspergillosis ; Carcinoma, Hepatocellular ; Hepatitis B virus ; Humans ; Liver ; Liver Transplantation ; Male ; Prognosis ; Recurrence ; Transplants