The spinal injuries were classified into bursting fracture, fracture-dislocation, seat-belt injury, compression fracture according to the three column theory by Denis. The bursting fracture and fracture-dislocation required the most careful planning. So, myelography, computerized tomography enabled us to diagnose the spinal fracture including retropulsed bony fragment into the spinal canal. There was much controversy as to appropriate treatment af unstable thoraco-lumbar fractures. The frequent surgical treatment of thoraco-lumbar spinal fractures was still posterior spinal instrumentation including Harrington rod system. Since 1964, the use of anterior spinal instrumentation had been started by Dwyer, Dunn, Kostrik, Slot, and Zielke used anterior spinal instrumentation in unstable thoraco-lumbar spinal fractures, but not popular. This study suggested the experience to accomplish the decompression of the neural elements and stabilization of the spine by using Kandea device in unstable thoraco-lumbar spinal fractures. 12 patients treated with this Kaneda device in unstable thoraco-lumbar spinal fractures were analyzed from Dec. 1988 to May, 1989 at the Department of Orthopaedic Surgery, Ewha Womans University Hospital. We obtained the following conclusions. The results were as follows. 1. The common injury mechanism was falling down in 5 cases, the frequent injury site was 1st lumbar vertebra. 2. According to Denis classification, the bursting fractures were in 8 cases(68% ), the fracture-dislocations were in 4 cases(33%). 3. The average preoperative kyphotic angulation was 24.5 degrees(range 8 to 45) and postoperative angulation was 5 degrees(range 2 to 15), the correction rate was 79.6% and correction degree was average 19.5 degrees. 4. The advantages were the fixation of one level above and below the injury site, sufficient neural decompression, firm spinal stabilization, early mobilization with a brace and elimination of the 2nd posterior procedure. 5. The fixation of vertebral plate was difficult due to the invariable size of vertebral plates, especially, in upper thoracic spinal fracture and children's fracture.
Accidental Falls ; Braces ; Classification ; Decompression ; Early Ambulation ; Female ; Fractures, Compression ; Humans ; Myelography ; Spinal Canal ; Spinal Fractures ; Spinal Injuries ; Spine

To evaluate the influence of intraoperative irradiation on the healing of jejunal anastomosis, an experimentalstudy was undertaken using a total of 150 rats. The bursting pressure of the normal jejunum was obtained in groupI. Group II was subjected to resection and anastomosis, and group III was irradiated on the anastomosed jejunumwith a single dose of 1,000 rads. Healing process was evaluated by measuring bursting pressure of the anastomosedjejunum on each postoperative day from 2nd to 14th, and on 21 th day. Bursting pressure was tested by inflatingthe loop of gut with water, and bursting sites were observed. The resuls obtained are summarized as follows; 1.The bursting pressure of the anastomosed jejunum retained normal strength by the 7th postoperative day in thenonirradiated group, whereas by the 11th postoperative day in the irradiated group. 2. Irradiation caused delay inthe healing of anastomosis of the jejunum until the 10th postoperative day; but after then, there was nosignificant difference in bursting pressure between both groups. 3. In the jejunal segments with normal strength,bursting occurred exclusively at the non-anastomotic site in both groups; Bursting started along the mesentericborder in the non-irradiated group, whereas rupture usually occurred on the antimesenteric border in theirradiated group. in the jejunal segments with subnormal strength, bursting usually started on the mesentericborder of the anastomotic site in both groups. The results indicate that intraoperative irradiation with a singledose of 1,000 rads causes no harmful effect on the healing of anastomosis of the jejunum in rats. Therefore, thisstudy suggests the possibility of more effective clinical application of intraoperative irradiation.
Animals ; Intestine, Small ; Jejunum ; Rats ; Rupture ; Water

PURPOSE: It is suggested that persistent hypocarbia caused by ventilator therapy could be a risk factor in PVL. The study is aimed to discover whether for preventing hypocarbia with combined use of gentle ventilation and high frequency ventilation, other factors would be causers of PVL. METHODS: Among 45 infants who were born and survived through ventilator treatment in the Fatima neonatal intensive care unit for four years from April 1996 to June 1999, 15 infants with PVL were classified as a study group and 30 without PVL as control group. The analysis was performed retrospectively with medical records. Ventilator treatment was based on the combined use of ventilation by means of the flow interruptor type of Infant Star . The aggressive weaning was performed when the clinical state, chest X-ray and arterial blood gas analysis became stabilized. RESULTS: Among 15 cases with PVL : 9 cases(60.0%) with fetal distress, 1 case(6.6%) with placenta previa, 1 case(6.6%) with placenta abruptio. In the relationship between PaCO2 variance on arterial blood gas analysis and PVL, the highest average of PaCO2 is 44.9 +/- 7.8 mmHg in the study group and 45.0 +/- 10.5 mmHg in the control group, which means there was not statistically significant difference. The PaCO2 concentration lower than 25 mmHg for three days appeared in one case in the study group. CONCLUSIONS: In cases of preventing hypocarbia by combined use of ventilation, it is suggested that the birth history and weaning method is important as risk factor of PVL.
Blood Gas Analysis ; Fetal Distress ; High-Frequency Ventilation* ; Humans ; Infant ; Infant, Newborn ; Intensive Care, Neonatal ; Leukomalacia, Periventricular* ; Medical Records ; Placenta ; Placenta Previa ; Reproductive History ; Retrospective Studies ; Risk Factors* ; Thorax ; Ventilation* ; Ventilators, Mechanical ; Weaning

No abstract available.
Lymphohistiocytosis, Hemophagocytic*

OBJECTIVES: Suicide is one of the most common causes of deaths in correctional institutions. This study aimed to examine the characteristics of suicide attempts and its related psycho-social factors in correctional institutions. METHODS: This study examined the characteristics of 101 suicide attempts from 2006 to 2007 in the two regional correctional headquarters. Thirty-seven male inmates (43 suicide attempts) and 40 matched controls were included in interviews and reviews of personal records. Psychiatric illnesses were examined using the Structured Clinical Interview for DSM-IV and medical outcomes of their suicide attempts with the Lethality Scale of Diagnostic Interview for Genetic Studies. RESULTS: Over a half of suicide attempts occurred in solitary cells and the most common method was hanging. Medically, 70% of the suicide attempts were more than severe. Poor social support, a lifetime history of suicide attempts, and incarceration were associated with suicide attempts. Additionally, psychiatric illnesses were more likely to increase the risk of suicide. CONCLUSION: This study implies that mental health issues and monitoring systems are important to reduce suicides in the correctional system. Regular checks and management of suicide risk and mental illness are crucial to prevent suicide in correctional institutions.
Cause of Death ; Diagnostic and Statistical Manual of Mental Disorders ; Humans ; Male ; Mental Health ; Risk Factors ; Suicide

BACKGROUND: Left ventricular hypertrophy is common in chronic renal failure patients and may contribute increased risk of cardiovascular morbidity and mortality. We evaluated the left ventricular morphology and function in renal transplant recipients to find the relationship between hemodynamic changes and morphologic and functional improvement after transplantation. METHODS: Serial echocardiographic evaluations were performed in 27 adults(20 men and 7 women) at the time of transplantaion and posttransplantation 1 month and 4 months. The average duration of hemodialysis was 16+/-24 months(mean+/-S.D.). RESULTS: At the time of transplantation, the hematocrit level was 21+/-6% and posttransplantation 1 month and 4 months, that was increased to 39+/-5% and 42+/-7%, respectively(p<0.001). Left ventricular mass index by echocardiography was decreased significantly from 246+/-87g/m2(pre-KT) to 169+/-38g/m2(post-KT 1 month) and 153+/-40g/m2(post-KT 4 months), respectively (p<0.001). Interventricular septal thickness and left ventricular posterior wall thickness were decreased significantly after 4 months of transplantation. Left ventricular systolic and diastolic dimensions were also decreased significantly after 1 month and 4 months of transplantation. Left ventricular volumes and cardiac output were also decreased significantly. But A/E ratio, ejection fraction and fractional shortening did not change significantly. CONCLUSION: These findings showed that pretransplant high output state was resolved radipidly(within 1 month) but the diastolic function did not improved after transplantation 1 month and 4 months.
Cardiac Output ; Echocardiography* ; Hematocrit ; Hemodynamics ; Humans ; Hypertrophy, Left Ventricular ; Kidney Failure, Chronic ; Kidney Transplantation ; Male ; Mortality ; Renal Dialysis ; Transplantation*

PURPOSE: This study was conducted to determine the correlation between the incidence of chronic lung disease and the combined use of gentle ventilation and high-frequency ventilation. METHODS: The subject group consisted of 63 very low birthweight infants of less than 1500gm who were born and survived through ventilator treatment in the Fatima neonatal intensive care unit for four years from January 1995 to December 1998. The analysis was performed retrospectively with medical records. Ventilator treatment was based on the combined use of gentle ventilation and high-frequency ventilation by means of the flow interruptor type of Infant star. High- frequency ventilation was carried out for 24 hours after surfactant replacement, when PaCO2 exceeded 60mmHg, or if the period of gentle ventilation exceeded one week. When the results of arterial blood gas analysis and the state of the body became stable, the aggressive weaning was performed. RESULTS: For 49(77.8%) of 63 infants, the weaning was possible within seven days. The other 14 infants(22.2%) needed ventilator treatment for more than seven days. The mean duration of ventilator treatment was 12.3 days. The causes of weaning failure included sepsis, patent ductus arteriosus, chronic lung disease, and intraventricular hemorrhage. Two infants who had received ventialtor treatment for more than two weeks were found to have incidence of chronic lung disease. CONCLUSION: It is suggested that the combined use of gentle ventilation and high-frequency ventilation can help reduce pulmonary damage, and it will be important to shorten the period of ventilator treatment.
Blood Gas Analysis ; Ductus Arteriosus, Patent ; Hemorrhage ; High-Frequency Ventilation ; Humans ; Incidence* ; Infant ; Infant, Newborn ; Intensive Care, Neonatal ; Lung Diseases* ; Lung* ; Medical Records ; Retrospective Studies ; Sepsis ; Ventilation* ; Ventilators, Mechanical ; Weaning

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels

Crohn's disease is a chronic and insidious condition characterized by an inflammatory process that may extend across all layers of the entire gastrointestinal tract. The common sites involved by Crohn's disease are the terminal ileum and ascending colon. Crohn's disease limited to the appendix is uncommon. Since its first report in 1953 by Meyerding and Bertram, 156 cases of appendiceal Crohn's disease have been documented in the world literature. We experienced a case of Crohn's disease limited to the appendix in a-35year-old female who were performed an ileocecectomy.
Appendix* ; Colon, Ascending ; Crohn Disease* ; Female ; Gastrointestinal Tract ; Humans ; Ileum