Successful block of the celiac plexus denervates the denervatives of the foregut and therefore can successfully interrupt nociceptive stimuli from the pancreas, stomach, liver, etc. Although permanent neurolytic block is much less successful for malignant chronic pancreatitis syndrome, it is specifically useful for treatment of intractable pain that often accompanies carcinoma of the pancreas or other upper abdominal visceral tumors. This was a case report in which intractable pain due to malignant gastric cancer was successfuly controlled by the permanent neurolytic celiac plexus block.
Celiac Plexus ; Liver ; Pain, Intractable ; Pancreas ; Pancreatitis, Chronic ; Stomach ; Stomach Neoplasms*

Many studies have shown that epidural narcotics produce prolonged analgesic action. We instillated 2mg of morphine on the dura just before wound closure which was exposed for lumbar laminectomy. Sixty patients scheduled for laminectomy were devided into two groups i.e., morphine group (30 patients) and control group(30 patients). The results of this study were as follows: 1) In morphine group, 17 patients (56.6%) tolerated the postoperative pain without narcotic injection for over 20 hours, but 13 patients(43.3%) of the control group required narcotic injection within 5 hours. 2) Severe respiratory depression was noted in two cases from the morphine group. 3) It is a very simple and effective method for postoperative pain control.
Humans ; Laminectomy ; Morphine* ; Narcotics ; Pain, Postoperative* ; Respiratory Insufficiency ; Wounds and Injuries

Since 1949, lithium has been widely used for treatment of manic depressive disorder. It has also been used for agranulocytosis after anticaneer chemotherapy and partially for hyperthyroidism. But it is well known that the long term administration of this drug is associated wih various antithyroid effects such as hypothyroidism, simple goiter, nodules and even thyrotoxicosis. Although the exact mechanism for leading hypothyroidism or goiter is still unknown, the incidence of lithium-induced hypothyroidism is 1-37% during lithium atment. We had an experience of newly developing goiter with or without hypothyroidism during lithium treatment in 4 MDP patients. Among our patients, the duration of lithium administration was from 0.7 months to 11 years, and the development of thyroid abnormality was impossible to predict. They were treated with thyroxine while lithium was discontinued causing favorable outcome. We suggest that routine thyroid function test include thyroid autoimmune antibody screening in patients planning to undergo lithium treatment.
Agranulocytosis ; Antithyroid Agents ; Depressive Disorder ; Drug Therapy ; Goiter* ; Humans ; Hyperthyroidism ; Hypothyroidism ; Incidence ; Lithium Carbonate* ; Lithium* ; Mass Screening ; Thyroid Function Tests ; Thyroid Gland ; Thyrotoxicosis ; Thyroxine

Down syndrome is perhaps the most common genetic condition associated with mental retardation. In cytogenetic examination, trisomy 21 is in 95% of Down syndrome, and the others are mosaicism, translocation or deletion. There are many associated diseases with Down syndrome such as, thyroid function abnormality, congenital heart disease, intestinal blockage, and so on. Hypothyroidism appeared in 15% before adolescent in Down syndrome patients. In Korea, there were several reports of Down syndrome with hypothyroidism in childhood but not in adulthood. And we had three cases of hypothyroidism with Down syndrome in adulthood. Cytogenetic examination revealed trisomy 21 in the 2 cases and 1 case of mosaicism. Antithyroid antibody was positive in one case. None of these cases was admitted due to symptoms of hypothyroidism. It is very difficult to make the diagnosis of hypothyroidism in Down syndrome because of similarity in symptoms between Down syndrome and hypothyroidism. Thus, periodic thyroid function test should be made in Down syndrome, and this could be a part of improving quality of life in Down syndrome.
Adolescent ; Adult* ; Congenital Abnormalities ; Cytogenetics ; Diagnosis ; Down Syndrome* ; Heart Diseases ; Humans ; Hypothyroidism* ; Intellectual Disability ; Korea ; Mosaicism ; Quality of Life ; Thyroid Function Tests ; Thyroid Gland

Abdominal pregnancy that is a life threatening variant of ectopic pregnancy, has been a rare event with high maternal mortality. It is very difficult to diagnose a abdominal pregnancy clinically. We have experienced a case of early abdominal pregnancy diagnosed at emergency laparotomy and this case was presented with a brief review of the literatures.
Emergencies ; Female ; Laparotomy ; Maternal Mortality ; Pregnancy ; Pregnancy, Abdominal* ; Pregnancy, Ectopic

BACKGROUND: The several forms of treatment of Graves disease-thyroidectomy, antithyroid drugs and radioiodide therapy-are in wide use now. But which therapy is best is a matter of debate. Some authors reported that in patients who underwent thyroidectomy, higher titers of serum antimicrosomal antibody were associated with 1) higher formation rates of germinal centers, 2) more lymphocyte infiltration in the thyroid tissue, 3) higher incidence of hypothyroidism, and 4) lower incidence of recurrence. We were interested in the relationship of thyroid autoantibody titers, ADCC(antibody-dependent cell-mediated cytotoxicity) activity and the clinical response to antithyroid medication. METHODS: We measured ADCC activities from patients in Graves disease(n-48), Hashimoto thyroiditis(n=17) and normal control(n=9). The patients of Graves disease were followed up for more than 1 year, and they were grouped into A(n=17, well responsed group to antithyroid medication) and B(n=31, poorly responsed group). We examined ADCC activities of patients' sera by chromium release assay. RESULTS: 1) Mean age of patients with Graves disease was 34.4210.4 years and 15 patients were male(31%). 2) Results of thyroid function tests of the Graves' patients were T 585.9 +/- 255.3 ng/dL, T4 21.3 +/- 12.2 mg/dL, TSH 0.11 +/- 0.06mIU/mL. Concentrations of antimicrosomal antibody, antithyroglobulin antibody and thyrotropin binding inhibitory immunoglobulin were 1279.1 +/- 1486.7 IU/mL, 488.1 +/- 751.1 IU/mL, and 38.5 +/- 33.4U/L respectively. 3) There was no significant difference between levels of thyroid hormones or concentrations of thyroid autoantibodies and ADCC activities in graves patients. 4) The ADCC activity of the Graves patient group(24.49%) was significantly higher than that of the normal control group(3.76%), and significantly lower than that of the Hashimotos thyroiditis group(36.34%). 5) There was no significant difference in ADCC activity between group A(18.24 +/- 13.44%) and B(27.91 +20.02%). CONCLUSION: From this results, we suggested that ADCC activity seems to be no value as a prognostic factor in predicting the response to antithyroid drugs in Graves disease patients. But, further studies, larger number of patients and long-term follow up, are needed.
Antibody-Dependent Cell Cytotoxicity ; Antithyroid Agents ; Autoantibodies ; Chromium ; Follow-Up Studies ; Germinal Center ; Graves Disease* ; Humans ; Hypothyroidism ; Immunoglobulins ; Incidence ; Lymphocytes ; Recurrence ; Thyroid Function Tests ; Thyroid Gland ; Thyroid Hormones ; Thyroidectomy ; Thyroiditis ; Thyrotropin

PURPOSE: Loss of hippocampal interneurons in dentate gyrus has been reported in patients with severe temporal lobe epilepsy and in animals treated with kainic acid(KA). Interneurons contain Ca2+- binding protein parvalbumin(PV). The effects of kainic acid on parvalbumin-immunoreactive (PV-IR) interneurons in dentate gyrus were investigated in organotypic hippocampal slice cultures. METHODS: Cultured hippocampal slices from postnatal day nine C57/BL6 mice were exposed to 10 muM KA, and were observed at 0, 8, 24, 48, 72 hours after a one hour KA exposure. Neuronal injury was determined by morphologic changes of PV-IR interneuron in dentate gyrus. RESULTS: Transient(1 hour) exposure of hippocampal explant cultures to KA produced marked varicosities in dendrites of PV-IR interneuron in dentate gyrus and the shaft of interbeaded dendrite is often much thinner than those in control. The presence of varicosities in dendrites was reversible with KA washout. The dendrites of KA treated explants were no longer beaded at 8, 24, 48 and 72 hours after KA exposure. The number of cells in PV-IR interneurons in dentate gyrus was decreased at 0, 8 hours after exposure. But there was no significant difference in 24, 48 and 72 hours recovery group compared with control group. CONCLUSIONS: The results suggested that loss of PV-IR interneurons in dentate gyrus is transient, and is not accompanied by PV-IR interneuronal cell death.
Animals ; Carrier Proteins ; Cell Death ; Dendrites ; Dentate Gyrus* ; Epilepsy* ; Epilepsy, Temporal Lobe ; Humans ; Interneurons* ; Kainic Acid ; Mice* ; Neurons

Changes in the levels of biogenic amines in different brain regions and the cerebrospinal fluid in rats were measured after acute or chronic treatment with tricyclic antidepressants. After single or 3 weeks' treatment with imipramine or desipramine, blocks of tissues were obtained from seven regions of the brain (frontal cortex, corpus striatum, hippocampus, thalamus, hypothalamus, substantia nigra and cerebellum) immediately after collection of the cerebrospinal fluid (CSF) from the cisterna magna. The concentrations of biogenic amines and their metabolites (norepinephrine, epinephrine, dopamine, 5-hydroxytryptamine (5-HT), dihydroxyphenylacetic acid (DOPAC), homovanillic acid (HVA), 5-hydroxyindoleacetic acid (5-HIAA)) in brain tissues and the CSF were measured using the high performance liquid chromatography-electrochemical detection system (HPLC-ECD). Treatment with desipramine or imipramine caused major alterations in the concentrations of central norepinephrine or 5-HT and its metabolite, respectively. Brain regional responses were variable according to the kind of tricyclic antidepressants and the duration of treatment. It is noteworthy that chronic treatment with both desipramine and imipramine caused altered hippocampal concentrations of norepinephrine and/or 5-HT and its metabolites. Striatal DOPAC concentrations were also changed after acute or chronic treatment with both drugs. These results suggest that tricyclic antidepressants altered neurotransmission according to the brain region, and the hippocampal norepinephrine and 5-HT and/or the striatal dopamine may have a significant role for the expression of antidepressant action of tricyclic antidepressants.
Animal ; Antidepressive Agents, Tricyclic/*pharmacology ; Biogenic Monoamines/*metabolism ; Brain/*drug effects/metabolism ; Desipramine/pharmacology ; Imipramine/pharmacology ; Male ; Rats ; Rats, Sprague-Dawley

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels