Objective To explore the expression and clinical significance of caudal homeobox gene CDX2 in acute myeloid leukemia(AML) patients .Methods Bone marrow (BM )and peripheral blood (PB)samples were colleted in 114 cases of donor AML patients and 56 patients undergoing chemotherapy .The CDX2 gene expression in every patient′s mononuclera cells were de‐tected by RT‐PCR .Among these patients ,19 cases were detected the gene continuous every three months .Eight healthy PB and five patients with iron deficiency anemia BM as control .Results CDX2 gene transcript levels were detectable in bone marrow mononu‐clear cells from 114 AML patients and 13 healthy donors ,but the level of gene expression was higher in AML patients(90/114 , 78 .9% ) .There was a statistically significant difference between the AML patients and normal donor (P< 0 .01) .The higher or lower expression of CDX2 gene showed no correlation with CR rate .CDX2 gene expression level had a positive correlation in BM and PB mononuclera cells(the correlation coefficient r= 0 .656 ,P< 0 .01) .The expression of CDX2 in patients with CR was 10 .3% -86 .2% of pre‐chemotherapy ,wihch decreased with the treatment course ,while elevated in recurrence .19 cases of patients underwent half a year of follow‐up ,there was no significant difference of the rate of early recurrence in two groups(P>0 .05) .Con‐clusion Higher expression level of CDX2 gene is mostly in AML patients ,but its expression has no relation with CR rate .CDX2 gene may be a prognostic molecular marker in AML patients ,and can be used to monitor the minimal residual disease of Normal chromosome karyotype AML .

Objective:A retrospective analysis was performed on clinical characteristics and deoxyguanosine kinase DGUOK gene mutations in a family with hepatocerebral mitochondrial DNA depletion syndrome (MTDPS). Methods:The clinical data, treatment process and gene detection results of a child with MTDPS in the second hospital of Hebei Medical University in April 2019 were analyzed and summarized.Results:Proband was a girl.From the first week of infantile, she suffered from recurrent hypoglycemia, hyperlactic acid, progressive cholestatic liver dysfunction, coagulopathy, difficult feeding, slow growth of body mass, microcephaly, hypotonia, and gradul intermittent binocular tremors, and eventually failed to thrive.Gene testing identified two compound heterozygous mutations c. 42-c.43insTTCA(p.F15fs129X)/c.808-1(IVS6)G>A in DGUOK gene.The former was a frame-shift mutation resulted in truncated protein and the later was a splicing mutation resulted in abnormal splicing.Each parent was a heterozygous carrier, and there were no mutations in the two sites with her elder sister. Conclusions:Both mutations were first reported worldwide. DGUOK gene mutations with MTDPS are important causes of infant liver failure.When hypoglycemia, hyperlactic acidemia and liver dysfunction occur in newborn and infant, MTDPS related gene DGUOK gene sequencing screening should be considered for early definitive diagnosis, or, when acute liver failure happen in infant and childhood, neuromuscular involvement is insufficient.

Objective To construct recombinant adeno-associated virus and lentivirus carrying siRNA of TIMP-1 and to investigate the efficiency of infection and short-term inhibitory effect of TIMP-1 gene expres-sion on rat hepatic stellate cells. Methods One pair of siRNA which could effectively inhibit expression of the TIMP-1 gene in HSC-T6 was screened and cloned into AAV vector and lentiviral vector to construct the recombinant AAV/siRNA-TIMP-1/GFP and Lenti/siRNA-TIMP-1/GFP. AAV/GFP and Lenti/GFP as neg-ative control were also obtained. Experiments were assigned to five groups: AAV/siRNA-TIMP-1/GFP, AAV/GFP, Lenti/siRNA-TIMP-1/GFP, Lenti/GFP group and mock group. Rat HSC-T6 cells were infected by these recombinant viruses at a concentration of MOI by 10. To monitor the efficiency of infection, fluores-cence microscope and flow cytometer were used. After 7 d post-infection, Western blot was used to detect the TIMP-1 protein expression. Results HSC-T6 had no significant changes after infection. The efficiency of infection in AAV/GFP and Lenti/GFP group were 72.7% and 70.0%, AAV/siRNA-TIMP-1/GFP and Lenti/siRNA-TIMP-1/GFP group were 64.58% and 61.86%. The protein expression levels of TIMP-1 in HSC-T6 cells at 7 d post-infection by the recombinant AAV and Lentivirus were decreased 40.0% compared with those in mock control and normal HSC-T6 (P<0.05). Conclusion Recombinant AAV/siRNA-TIMP-1/GFP and Lenti/siRNA-TIMP-1/GFP could effectively infect HSC-T6 with similar efficiency and suppress the expression of TIMP-1 in rat HSC-T6 remarkably.

Objective:To investigate clinical characteristics and ABCB11 gene mutations in probands suffering from progressive familial intrahepatic cholestasis type 2(PFIC2). Methods:The clinical data involving manifestations and laboratory examinations of 2 probands with PFIC2 admitted to Pediatric Digestive and liver Clinic in Second Hospital of Hebei Medical University during January 2017 to December 2018 were retrospectively analyzed.Target capture high-throughput sequencing, genome-wide gene copy number variation(CNV) detection and validation were performed on probands and their parental DNA.Results:The age of onset for the 2 probands ranged from 2 to 5 months, and they had hepatosplenomegaly, severe cholestasis, pruritus, and binding bilirubin/ total bilirubin (proband 1: 51.8%-77.5%, proband 2: 47.1%-66.5%). Bile acid and aminotransferase[mainly aspartate transaminase (AST)] increased, but γ-glutamyltransferase(GGT) remained normal.Compound heterozygous mutations of ABCBll gene were discovered in proband 1: single strand deletion/c.3213+ 5G>A splicing mutation, and deletion mutation were spontaneous mutation.A total of 2.256 Mb(chr2 2q24.3q31.1)was missing, whereas splicing mutation was originated from her father.Polymorphisms with Val444Ala(T1331C)and Ala1028Ala(A3084G)were proved in proband 1.Compound heterozygous mutations of ABCB11 gene were revealed in proband 2: c.1483A>G(p.R495G)/c.2594C>T(p.A865V), and both parents were heterozygous carriers.Single-strand 2.256 Mb deletion in proband 1 and 2 mutations in proband 2 were unreported new mutations worldwide. Conclusions:In clinical work, children with cholestasis, elevated bile acid and transaminase(mainly AST), but normal GGT, should be detected for PFIC genes as soon as possible.

ObjectiveTo analyze the research status and trends in low-level occupational benzene exposure. Methods Articles on low-level occupational benzene exposure from Chinese and English journals from January 1st, 2000, to December 31th, 2022 were retrieved using the Web of Science and the China National Knowledge Infrastructure, and a bibliometric analysis was conducted. Results A total of 327 articles were included in the analysis, comprising 216 English articles and 111 Chinese articles. i) The number of articles published in English fluctuates greatly over the years, without a trend of continuous growth or decline. Authors from 359 research institutions in 45 countries and regions have published relevant English articles in 97 kinds of journals, involving 281 grants from 226 foundations. The top three countries in terms of articles amount were the United States, Italy, and China, with 81, 46, and 43 papers, respectively. The English articles mainly focused on mechanistic research at the genetic level, such as hematotoxicity, oxidative stress, and DNA damage. ii) The number of Chinese articles increased gradually after 2012, with the growth peak in 2017. Authors from 127 research institutions in 26 provinces, autonomous regions, and municipalities published Chinese articles in 51 kinds of journals, involving 154 grants from 78 foundations. Chinese articles tended to focus on benzene-induced hematotoxicity and occupational health damage. Conclusion Most studies on low-level occupational benzene exposure were conducted in China, the United States and Italy, focused on hematotoxicity. Monitoring international research topics and hotspots of the field has certain reference value for related research in China.

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Objective To explore the effect of robot assistance on the gait kinematics of hemiplegic persons after a stroke.Methods Forty hemiplegic stroke patients were randomly divided into an experimental group and a control group,each of 20.Both groups were given routine neurological medication and rehabilitation training,while the experimental group was additionally provided with 20 minutes of robot-assisted gait training daily,six times a week,for 8 weeks.Before and after the intervention,both groups' motor function,balance,step length and pace were evaluated,as well as their pelvic rotation angles,side inclination,vertical displacement and lateral displacement.The Fugl-Meyer assessment for the lower extremities (FMA-LE) was used along with the Berg balance scale (BBS),the gait analysis system of Biodex Gait Trainer-2 equipment.Results After the treatment,the average FMA-LE score,BBS score,pace and step length of the experimental group were all significantly better than the before the treatment and significantly better than the control group's averages after the treatment.The improvements observed in the pelvic rotation angle,side inclination,vertical displacement and lateral displacement were all significant.Conclusion Robot assistance can usefully supplement routine rehabilitation training after stroke.It can improve control of the pelvis,enhance walking and balance and generally improve the motor function of the lower extremities.

Objective: To study the chemical constituents from traditional Chinese (Mongolian) medicine, Lomatogonium carinthiacum and Halenia corniculate. Methods: The chemical constituents were isolated and purified by silicagel column, Sephadex LH-20, ODS and high performance liquid chromategramphy. The structures were identified by NMR and MS analysis technics. Results: Twelve compounds were isolated and identified as isovitexin (1), Luteolin-5-O-β-D-glucoside (2), Isosaponarin (3), Luteolin-7-O-β-D-glucoside (4,7), 1,4,8-Trimethoxy-xanthone-6-O-β-D-glucoronyl-(1 → 6)O-β-Dglucoside (5), friginosideD (6), 1-hydroxy-2,3,5-trimethoxyxanthone (8), 1-hydroxy-2,3,4,5-tetramethoxyxanthone (9), 1-hydroxy-2,3,4,7-tetramethoxyxanthone(10), 1-hydroxy-2,3,4,5,7-pentamethoxyxanthone (11) and usnic acid (12). Conclusion: Compounds 6 and 12 are obtained from L. carinthiacum and H. corniculate for the first time.

Background Some studies have found that exposure to heavy metals significantly increases the risk of nonalcoholic fatty liver disease (NAFLD), and welding operators in automobile manufacturing enterprises are exposed to heavy metals in the working environment. Objective To analyze the prevalence and related factors of NAFLD in workers of an automobile company in Guangzhou. Methods From January 1 of 2023 to December 31 of 2023, 5463 workers of an automobile company in Guangzhou who participated in the physical examination in the Occupational Health Surveillance Centre of Guangzhou Occupational Disease Prevention and Treatment Hospital were selected as research subjects. The general data, laboratory examinations, B-ultrasound examinations, and other data of the subjects were obtained through the physical examination system. The exposed occupational hazards were identified based on the workplace hazard surveillance report provided by the automotive company. Logistic regression was used to analyze potential influencing factors of NAFLD, and stratified analysis was used to adjust confounding factors according to the stepwise model to evaluate the relationship between exposure to manganese and its inorganic compounds and NAFLD. Results A total of 2129 cases (38.97%) were reported positive NAFLD. The results of logistic regression analysis showed that women had a lower risk of NAFLD (OR=0.40, 95%CI: 0.25, 0.64), while age > 25 years old (OR=1.49, 95%CI: 1.39, 1.60), body mass index (BMI) ≥24 kg·m⁻² (OR=7.54, 95%CI: 6.46, 8.79), and elevated alanine aminotransferase (ALT) (OR=4.87, 95%CI: 3.73, 6.36), γ-glutamyl transpeptidase (γ-GGT) (OR=1.54, 95%CI: 1.17, 2.02), triglyceride (TG) (OR=3.47, 95%CI: 2.92, 4.14), and fasting blood glucose (OR=1.70, 95%CI: 1.32, 2.20) associated with a higher risk of NAFLD. NAFLD was positive in 39.40% of heavy metal exposed workers (701/1779). NAFLD was positive in 45.19% of workers exposed to manganese and its inorganic compounds (169/374), and among workers over 34 years old, exposure to manganese and its inorganic compounds (OR=1.79, 95%CI: 1.07, 2.97) significantly increased the prevalence of NAFLD. Conclusion The association between heavy metal exposure and NAFLD in workers of an automobile enterprise in Guangzhou is not significant, but age and gender are related to the prevalence of NAFLD. BMI, ALT, γ-GGT, TG, and fasting blood glucose are positively correlated with the prevalence of NAFLD. Exposure to manganese and its inorganic compounds in welding workers of the automobile enterprise is associated with elevated risk of the disease, and the prevalence of NAFLD is significantly increased in workers over 34 years old.

Aristolochic acids (AAs) have long been considered as a potent carcinogen due to its nephrotoxicity. Aristolochic acid I (AAI) reacts with DNA to form covalent aristolactam (AL)-DNA adducts, leading to subsequent A to T transversion mutation, commonly referred as AA mutational signature. Previous research inferred that AAs were widely implicated in liver cancer throughout Asia. In this study, we explored whether AAs exposure was the main cause of liver cancer in the context of HBV infection in mainland China. Totally 1256 liver cancer samples were randomly retrieved from 3 medical centers and a refined bioanalytical method was used to detect AAI-DNA adducts. 5.10% of these samples could be identified as AAI positive exposure. Whole genome sequencing suggested 8.41% of 107 liver cancer patients exhibited the dominant AA mutational signature, indicating a relatively low overall AAI exposure rate. In animal models, long-term administration of AAI barely increased liver tumorigenesis in adult mice, opposite from its tumor-inducing role when subjected to infant mice. Furthermore, AAI induced dose-dependent accumulation of AA-DNA adduct in target organs in adult mice, with the most detected in kidney instead of liver. Taken together, our data indicate that AA exposure was not the major threat of liver cancer in adulthood.