BACKGROUND:Transferrin (Tf) is one suitable ligand to be conjugated to drug delivery systems to achieve site-specific targeting and desired therapeutic effect, due to its specific binding to transferrin receptors (TfR), and high expression on the surface of tumor cells. Contrast agents are also modified with Tf to achieve specific tumor imaging. OBJECTIVE:To prepare Tf-labeled magnetoliposomes (MLs), and characterize their utility as TfR targeted MR specific contrast agent in vitro. METHODS:MLs and Tf-MLs were prepared by lipid film hydration method and covalent coupling method, respectively. Tf-MLs were characterized by their mean size, zeta potential, polyindex, r2 relaxivity, Tf-binding efficacy and cytotoxicity.In vitro MRI contrasting properties of the suspended nanoparticles incubated with HepG2 cells were determined. RESULTS AND CONCLUSION:The mean diameter, polydisperisity index, zeta potential and r2 relexivity of Tf-ML were 95.1 nm, 0.21,-1.25 mv and 94.62 mmol-1/s, respectively. The coupling efficiency was calculated and the values obtained were 59.4 μg Tf/μmol phospholipid corresponding to about 27 molecules of Tf-MLs. After a 2-hour incubation with rhodamine-labeled Tf-MLs, rhodamine fluorescence was detected intensively in the plasma membrane and the cytoplasm of the TfR-overexpressing HepG2 cells. In contrast, Tf-ML showed little binding in MCF-7 cells that had low TfR level. HepG2 cels incubated with Tf-ML showed much higher intracellualar iron density than incubated with non-targeted MLs.In vitro MR T2WI of cells demonstrated the centrifuge tube containing HepG2 cells incubated with Tf-MLs produced a lower visible signal intensity than that treated with non-targeted MLs. Tf-MLs showed their potentials such as high r2 relaxivity, specific binding ability characteristics. These results suggest the availability of Tf-MLs to serve as a targeted contrast agent.

The structure of the hyperbaric oxygen chamber was introduced, and the application of automatic control system to the chamber was discussed from the aspects of the function and information system. The automatic control system can be used for monitoring and control of equipment condition, operation flow and performance data during hyperbaric oxygen therapy, which enhances the efficiency and safety of hyperbaric oxygen chamber.

Objective:To study the transdermal characteristics of myrrh essential oil and its percutaneous penetration enhancement for ibuprofen. Methods:The content of ibuprofen was determined by HPLC. Ibuprofen was used as the model drug and mouse skin was used as the permeation barrier in vitro. The transdermal properties of myrrh essential oil and its effect on percutaneous absorption of ibuprofen were investigated using Franz diffusion cells. Results:Without myrrh essential oil or with 1%, 2% and 3% myrrh essential oil, the cumulative transdermal penetration amount in 12h of ibuprofen in vitro was (0. 427 05 ± 0. 069 82), (0. 315 04 ± 0. 032 24), (0.230 50 ±0.031 14) and (0.181 34 ±0.053 70) mg·cm-2, with Jss of(0.031 4 ±0.005 7), (0.020 8 ±0.002 8), (0.017 2 ±0.001 6) and (0.013 9 ±0.003 4) mg·(cm2·h) -1, respectively. Conclusion: Myrrh essential oil shows no transdermal en-hancement for ibuprofen in vitro, to the contrary, it shows inhibitory effect with positive correlation to the concentration.

Objective:To explore and compare the value of radiomic features based on 18F-fluorodeoxyglucose (FDG) PET and CT in distinguishing epidermal growth factor receptor (EGFR) mutation status in patients with lung adenocarcinoma. Methods:Pretreatment 18F-FDG PET/CT images and EGFR gene status of 114 patients (64 males and 50 females, aged range: 35-84 (average age: 61) years) with primary lung adenocarcinoma between January 2017 and December 2017 were retrospectively collected. The volume of interest was drawn manually slice by slice, then the features were extracted by the LIFEx software. The parameters were screened by least absolute shrinkage and selection operator (LASSO) method for 200 times, and ten-fold cross-validation was used to select the best tuning parameter λ. Three models, namely M PET, M CT, M PET+ CT, were constructed by binary logistic stepwise regression. The receiver operating characteristic (ROC) curve was generated and the corresponding area under the curve (AUC), sensitivity, specificity and accuracy were calculated. The AUCs of three models were compared by Delong test. Results:Totally, 53.51%(61/114) patients were with wild type EGFR and 46.49%(53/114) patients had EGFR mutation. There were 3, 3, 7 parameters selected to form M PET, M CT, M PET+ CT, respectively. The AUCs for M PET, M CT, M PET+ CT were 0.730, 0.752 and 0.866 respectively. When the cut-off values were 0.427, 0.522, 0.378 for M PET, M CT and M PET+ CT, the Youden index were up to the maximum as 0.420, 0.405, 0.630, with sensitivities of 83.0%(44/53), 58.5%(31/53), 92.5%(49/53), specificities of 59.0%(36/61), 82.0%(50/61), 70.5%(43/61) and accuracies of 70.2%(80/114), 71.1%(81/114), 80.7%(92/114), respectively. There was no significant difference between AUC of M PET and M CT ( z=-0.320, P>0.05). The differences of AUCs between M PET+ CT and M PET, M PET+ CT and M CT were statistically significant ( z values: 2.963, 2.523, both P<0.05). Conclusions:PET, CT and PET+ CT radiomic features are all associated with EGFR gene expression in lung adenocarcinoma. M PET+ CT has the highest predictive efficiency.

Objective To test the effectiveness, reliability and acceptability of the European Organization for Research and Treatment of Cancer (EORTC) QLQ-STO22 scale in gastric cancer patients in China. Methods One hundred and twenty-eight cases were collected in the Affiliated Cancer Hospital of Xiangya School of Medicine of Central South University from September 2014 to April 2015. All the patients completed the EORTC QLQ-STO22 and EORTC QLQ-C30 scales and given the Zubrod-ECOG-WHO (ZPS) score. Karen Bach coefficient and Pearson correlation test were used for statistical analysis while using ZPS score to detect EORTC QLQ-STO22 in validity. After score was standardized, P<0.05 represented the difference had statistical significance. Results The Karen Bach coefficient was 0.607-0.830, confirming that the EORTC QLQ-STO22 scale had good reliability. A number of enhanced analysis showed that the scale had good convergent validity and divergent validity. In the same or similar dimension, EORTC QLQ-C30 and EORTC QLQ-STO22 scales had good correlation and the correlation scores were higher than 0.400. The patients were divided into four groups according to ZPS score, with ZPS score increase, the overall quality of life scores were decreasing and entries associated with symptoms were increasing, showing difference between different groups(P<0.05). Conclusion The EORTC QLQ-STO22 scale shows high reliability and validity that can be used for assessing the quality of life of patients with advanced gastric cancer in China.

Aim To explore the protective effects of LPPC ( procyanidins extracted from the litchi pericarp) on cardiomyocyte apoptosis in septic rats and its mech-anisms. Methods The rats were randomly divided in-to 5 groups, and were given orally the drug for two weeks continuously. The control group ( control) and sepsis model group ( LPS ) were given distilled water once a day. LPPC low, medium and high dose groups were given LPPC 50 , 100 , 200 mg · kg-1 · d-1 re-spectively which were prepared freshly every day. After the treatment, sepsis animal models were established. Except for the control group, other groups were injec-ted LPS (lipopolysacchride, 10mg·kg-1) intraperito-neally to induce acute sepsis model. 4hrs later, rat se-rum was collected, isoenzyme ( CK-MB ) , lactate de-hydrogenase ( LDH ) and activity of aspertate amin-otransferase ( AST/GOT) were detected. Then rat car-diac tissue was obtained and cardiac tissue malondial-dehyde ( MDA ) , total antioxidant capacity ( T-AOC ) and reduced glutathione ( GSH ) content were deter-mined. TUNEL staining was performed to analyze the apoptosis of myocardial cells. Cleaved caspase-3 and TNF alpha protein expressions were analyzed by West-ern blot. Results Compared with the control group ( control) , serum of sepsis model group rats CK-MB, LDH, AST/GOT and cardiac tissue MDA content were significantly increased (P<0. 01). At the same time, the activity of cardiac tissue T-AOC and GSH de-creased obviously ( P<0. 01 ) . The apoptotic myocar-dial cells increased significantly ( P<0. 01 ) , and the expression level of cleaved caspase-3 and TNF alpha decreased obviously ( P <0. 01 ) . LPPC pretreatment significantly decreased the serum CK-MB, LDH, AST/GOT and tissue MDA content, increased tissue T AOC and GSH activity, attenuated apoptosis of rat myocardi-al cells significantly, and decreased expression level of cleaved caspase-3 and TNF alpha. Conclusion LPPC pretreatment can significantly attenuate rat myocardial cell apoptosis induced by sepsis, and the underlying mechanisms may be related to its anti-oxidative effects.

DECIDE-Diet trial was taken as a case to introduce the methods of blinding and blinding assessment for feeding trials, report the details of blinding, conduct a blinding survey and calculate Jame's BI and Bang's BI. Jame's BI was 0.683 (95% CI: 0.593~0.772). The Bang's BI for the intervention group was 0.340 (95% CI: 0.199~0.481), and for the control group was 0.086 (95% CI: -0.060~0.231). The blinding of the DECIDE)-Diet was generally successful, but the intervention group may infer their group to a certain extent. Feeding trials should report the details of blinding and consider blinding assessment.

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics

Objective To study the trends in surgical treatment and the outcomes of critical acute pancreatitis (CAP).Methods The clinical data of 76 patients with CAP who were treated in the Department of Biliopancreatic Surgery of the Xiangya Hospital,Central South University from January 2010 to December 2017 were retrospectively reviewed.Data which included demographics,micro-organisms,surgical interventions and mortality were compared between the time periods of 2010 to 2013 and 2014 to 2017.Results Before 2014,19 patients with CAP were treated in the Department of Biliopancreatic Surgery of the Xiangya Hospital,Central South University.The percentage of multidrug resistant organisms (MDRO) in pancreatic drainage was 5.3％ (1/19).In the latter 4 years,57 patients with CAP were treated.The percentage of MDRO was 50.9％ (29/57),which was significandy higher than the initial 4 years (P＜0.001).For surgical treatment,the proportion of minimally invasive surgery in the latter 4 years was significantly higher than that in the initial 4 years.The percentage of percutaneous catheter drainage (PCD) increased from 63.2％ in the initial 4 years to 86.0％ in the latter 4 years.The proportion of minimal access retroperitoneal pancreatic necrosectomy (MARPN) increased from zero in the initial 4 years to 59.6％,while the proportion of open pancreatic necrosectomy (OPN) decreased from 68.4％ in the initial 4 years to 24.6％.The mortality rate of patients with CAP dropped from 52.6％ (10/19) in the initial 4 years to 24.6％ (14/57) in the latter four years.Conclusions In the center which specializes in treating pancreatitis,although the problem of bacterial resistance had become increasingly prominent,the mortality rate of CAP had shown a significant downward trend due to the development of various minimally invasive techniques.

Objective To compare the safety and effectiveness of drug-eluting balloon (DEB) with paclitaxel and drug eluting stent (DES) in treating in-stent restenosis (ISR).Methods The clinical data of a total of 76 patients with ISR,who were admitted to authors' hospital to receive stem implantation during the period from January 2012 to September 2014,were retrospectively analyzed.According to the therapeutic means,the patients were divided into paclitaxel DEB group (n=32) and paclitaxel DES group (n=44).The general clinical information and coronary artery angiography findings were collected.The patients were followed up for one year;the all-cause mortality,cardiac death,myocardial infarction,in-stent thrombosis,target lesion revascularization,target vessel revascularization,and major adverse cardiac events were documented.Results No obvious difference in the general data of patients existed between group DEB and group DES (P＞0.05).The incidences of left anterior descending artery ISR in DEB group and in DES group were 43.75％ and 47.73％ respectively.The ISR target vessel types of the two groups were quite similar (P＞0.05).No statistically significant differences in ISR type,ISR lesion type and characteristics of in-stent restenosis existed between the two groups (P＞0.05).One-year following-up examinations indicated that no statistically significant differences in all-cause mortality,cardiac death,myocardial infarction,in-stent thrombosis,target lesion revascularization,target vessel revascularization,and major adverse cardiac events existed between the two groups (P＞0.05).Further analysis revealed that no significant difference in event-free survival existed between the two groups (P＞0.05).Conclusion For the treatment of ISR,the use of paclitaxel DEB is safe and feasible,its curative effect is not less than DES.