1.Clinical Observation on Treatment of Chronic Pelvic Inflammatory Disease with the Combination of Retention Enema,Acupuncture and Microwave Physical Therapy
Shuhong JIANG ; Changjun ZHENG ; Faao YU
International Journal of Traditional Chinese Medicine 2008;30(4):290,294-
Objective To explore the effect of treating chronic pelvic inflammatory disease with the combination of retention enema,acupuncture and microwave physical therapy.Methods 80 patients were randomly assigned into two groups:a treatment group(50 cases) treated with combination of retention enema,acupuncture and microwave physical therapy,and a control group (30 cases) treated with Fuyankang capsule.The efficiency was observed after the treatment.Results The total effective rate in the treatment group was 92.0%,showing significant difference (P<0.05) compared with the control group.Conclusion The triple-combined therapy of retention enema,acupuncture and microwave physical therapy has sound effect in treating chronic pelvic inflammatory disease.
2.Coumarins of Anemone raddeana Regel and their biological activity.
Fengzhi REN ; Shuhong CHEN ; Zhihui ZHENG ; Xuexia ZHANG ; Lihong LI ; Aihua DONG
Acta Pharmaceutica Sinica 2012;47(2):206-9
To study the coumarins of Anemone raddeana Regel, the compounds were separated by silica gel column chromatography and HPLC. Their structures were identified by their physicochemical property and spectral analysis. Two new compounds were isolated and identified as 4, 7-dimethoxyl-5-methyl-6-hydroxy coumarin (1) and 4, 7-dimethoxyl-5-formyl-6-hydroxycoumarin (2). The bioassays indicated that compounds 1 and 2 could significantly inhibit the proliferation of cancer cell, and showed the agonist effect on the transactivity of retinoic acid receptor-alpha (RARalpha). In addition, the two compounds had inhibitory effect against human leukocyte elastase (HLE).
3.Impacts of emotional health and quality of life on the cognitive functions of epileptics
Wanhong CHEN ; Fang YANG ; Zheng DAI ; Shuhong YU ; Wei SHI ; Guanghui CHEN ; Renliang ZHANG
Journal of Medical Postgraduates 2017;30(4):384-388
Objective At present, the risk factors for cognitive impairment in epilepsy patients are not quite clear.This study was to explore the impacts of the clinical features, emotional health and quality of life (QOL) on the cognitive function of the adult patients with mild cognitive impairment (MCI).Methods Using the Montreal Cognitive Assessment (MoCA) and Mini Mental State Examination (MMSE) scales, we evaluated the cognitive functions of the 109 adult epileptics of the outpatient clinic of neurology in Jinling Hospital.We assessed their emotional health with Hamilton Depression Scale-24 (HAMD-24), estimated their QOL with Quality Of Life in Epilepsy-31 (QOLIE-31), and collected their baseline clinical data by questionnaire survey.Results There were 67 cases of MCI (61.5%) among the 109 patients.The residential area was the strongest predictor of MCI in the adult epileptics (OR=0.226, 95% CI: 0.082-0.627).Among other risk factors of post-epileptic MCI were the total scores of HAMD-24 (OR=0.770, 95% CI: 0.644-0.921) and QOLIE-31 (OR=0.712, 95% CI: 0.575-0.880), QOL (OR=1.070, 95% CI: 1.015-1.128), cognitive function (OR=1.120, 95% CI: 1.043-1.203), and social function (OR=1.103, 95% CI: 1.035-1.175).Conclusion The incidence of MCI is high in adult patients with epilepsy.The development and progression of post-epileptic MCI can be delayed by more emphasis on the evaluation of cognitive function, emotional health, and quality of life.
4.A case of Bainbridge-Ropers syndrome with autism in conjunct with ASXL3 gene variant and its clinical analysis.
Shuhong ZHENG ; Hairui CHEN ; Miaojun MO
Chinese Journal of Medical Genetics 2021;38(7):671-673
OBJECTIVE:
To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.
METHODS:
High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.
RESULTS:
The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.
CONCLUSION
The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics*
;
Child
;
Developmental Disabilities
;
Female
;
Humans
;
Mutation
;
Retrospective Studies
;
Syndrome
;
Transcription Factors/genetics*
5.Clinical value of ultrasound-guided fine-needle aspiration biopsy in the diagnosis of thyroid cancer and assessment of cervical lymph node metastasis
Hao WANG ; Shuhong YAN ; Lei ZHENG ; Xiaojuan ZHENG
Chinese Journal of Primary Medicine and Pharmacy 2023;30(6):829-834
Objective:To explore the clinical value of ultrasound-guided fine-needle aspiration biopsy in the diagnosis of thyroid cancer and assessment of cervical lymph node metastasis.Methods:The clinical data of 90 patients with thyroid cancer who received treatment in Zhoushan Hospital from October 2018 to April 2021 were retrospectively analyzed. All patients underwent a two-dimensional ultrasound examination and ultrasound-guided fine-needle aspiration biopsy before surgery. Taking surgical and pathological diagnosis as the gold standard, the efficiency of two-dimensional ultrasound examination versus ultrasound-guided fine-needle aspiration biopsy in the diagnosis of thyroid cancer and cervical lymph node metastasis and in the identification of benign and maligant lymph nodes were investigated. Multivariate Logistic regression analysis was performed to analyze the correlation between different ultrasound signs and the detection rate of lymph nodes. Results:Pathological results showed that among the 90 patients, 73 patients had thyroid cancer, and 17 patients had benign lesions. Ultrasound-guided fine-needle aspiration biopsy results showed that 70 patients had thyroid cancer, and 20 patients had benign lesions, including 4 cases of missed diagnosis and 2 cases of misdiagnosis. The diagnostic sensitivity, specificity, accuracy rate, and Kappa value were 94.52%, 88.24%, 93.33%, and 0.79, respectively. These were highly consistent with the surgical and pathological diagnosis (Kappa value > 0.75). Two-dimensional ultrasound revealed 69 patients with thyroid cancer and 21 patients with benign lesions, including 7 cases of missed diagnosis and 4 cases of misdiagnosis. The diagnostic sensitivity, specificity, accuracy rate, and Kappa value were 90.41%, 76.47%, 87.78%, and 0.63, respectively. Pathological results revealed that cervical lymph node metastasis occurred in 12 patients, and it did not occur in 78 patients. The diagnostic sensitivity, specificity, accuracy rate, and Kappa value of ultrasound-guided fine-needle aspiration biopsy were 83.33%, 97.50%, 95.65%, and 0.81 respectively. These were highly consistent with surgical and pathological results (Kappa value > 0.75). The diagnostic sensitivity, specificity, accuracy rate, and Kappa value of two-dimensional ultrasound examination were 75.00%, 94.87%, 92.22%, and 0.67, respectively. A total of 156 lymph nodes were detected by ultrasound-guided fine-needle aspiration biopsy, including 103 benign lymph nodes and 53 malignant lymph nodes, with a diagnostic accuracy rate of 94.17% and 96.22%, respectively. A total of 173 lymph nodes were detected by two-dimensional ultrasound, including 111 benign lymph nodes and 62 malignant lymph nodes, with a diagnostic accuracy rate of 91.89% and 91.93%, respectively. There were no significant differences in the diagnostic accuracy of benign and malignant lymph nodes between the two examination methods ( χ2 = 0.42, 0.92, both P > 0.05). Multivariate logistic regression analysis showed that hyperechoic masses, cystic lesions, and internal calcification were significantly correlated with the detection rate of lymph nodes diagnosed by two-dimensional ultrasound and ultrasound-guided fine-needle aspiration biopsy ( OR = 6.64, 5.32, 4.12, 7.07, 5.60, 5.06, all P < 0.05). Conclusion:Ultrasound-guided fine-needle aspiration biopsy has high diagnostic efficiency for thyroid cancer and cervical lymph node metastasis. Ultrasound signs of hyperechoic mass, cystic lesions, and internal calcification are significantly correlated with the detection rate of lymph nodes.
6.Comparsion of PTC and ERCP for the treatment of biliary tract stricture after liver transplantation
Genshu WANG ; Changmou XU ; Keke HE ; Fengping ZHENG ; Zaibo JIANG ; Hua LI ; Chi XU ; Shuhong YI ; Jian ZHANG ; Yang YANG ; Guihua CHEN ; Hong SHAN
Chinese Journal of General Surgery 2012;(11):920-923
Objective To compare the efficacy of percutaneous and endoscopic treatment for the biliary stricture(BS) after liver transplantation (LT).Methods The result of percutaneous transhepatic cholangiography (PTC) and drainage ( PTC group) and endoscopic retrograde cholangiopancreatography (ERCP group) for the BS in 132 post-LT patients were analyzed retrospectively.Ninety-nine patients received PTC treatment,and 59 patients received ERCP treatment,26 patients converted to PTC treatment because of the poor efficacy or failure of the ERCP treatment.The operation success rate,complication rate,cure rate and remission rate of the two groups were compared with X2 test.Results The BS types of PTC and ERCP group were different significantly( P < 0.01 ),with more non-anostomotic stricture in PTC group and more anostomotic stricture in ERCP group.The operation success rate of PTC group was higher than of ERCP group( 100% vs 97% ) (P <0.01 ),and the complication rate of PTC group was lower than of ERCP group.The overall cure and remission rate of PTC and ERCP group were not different significantly(32.3% vs 45.8%,94.9% vs 88.1% ) (P >0.05).The cure and remission rate of PTC and ERCP treatment for each subtype of BS were not different significantly ( P > 0.05 ).Conclusions The efficacy of PTC treatment for the post-LT BS is equivalent to that of ERCP treatment.PTC can be considered the first-line option for the post-LT BS.
7.Data quality analysis of regional health information platform of community medical institutions in Beijing
Zhao YANG ; Shuhong ZHU ; Jicheng LV ; Xizi ZHENG ; Miao HUI ; Lingyi XU ; Li YANG
Chinese Journal of Medical Science Research Management 2023;36(6):465-468
Objective:This study aims to analyze of the quality of diagnosis and treatment data of community medical institutions on the national health information platform in a district of Beijing from the perspective of scientific research informatization, to provide experience and reference for promoting the informatization construction of primary medical units and tapping the scientific research potential of the regional data platform.Methods:Based on the data backup database of the national health information platform in the region, the data quality was analyzed and evaluated mainly in three dimensions: integrity, integration, and consistency.Results:Through the construction of the national health information platform, the district successfully achieved the effective collection of diagnosis and treatment data from community medical institutions, covering the main data such as patients′ basic information, visit information, test information, prescription information, etc. However, the data collected so far were still insufficient in terms of data integration and consistency.Conclusions:A regional medical data center is suggested to construct to break down the barriers between data systems, conduct pre-structuring of diagnosis and treatment data, improve data integration and consistency, and at the same time, carry out effective scientific research prospective design to promote the effective transformation of clinical data to scientific research data.
8.Association of vitamin D receptor Fok I and Bsm I polymorphisms with dyslipidemias in elderly male patients with type 2 diabetes.
Zheng XIA ; Yazhuo HU ; Honghong ZHANG ; Zhitao HAN ; Jie BAI ; Shuhong FU ; Xinli DENG ; Yao HE
Journal of Southern Medical University 2014;34(11):1562-1568
OBJECTIVETo assess the association of vitamin D receptor (VDR) gene Fok I and Bsm I polymorphisms with dyslipidemia in elderly male patients with type 2 diabetes of Han nationality.
METHODSA total of 328 elderly male residents of Han nationality in Beijing, including 237 type 2 diabetic patients and 91 healthy control subjects, were enrolled in this study. The diabetic patients were divided into non-dyslipidemia group (DO group, n=134) and dyslipidemia group (DH group, n=103). All the participants were genotyped for Fok I and Bsm I polymorphisms in VDR gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing technology, and the results were compared with their clinical characteristics.
RESULTSFor Fok I, the frequency of F allele was significantly higher in the diabetic patients than in the control group (Χ(2)=3.873, P=0.049, OR=1.439, 95% CI: 1.001-2.071). In the dominant model, the frequency of FF genotype was significantly higher in the diabetic group (Χ(2)=5.057, P=0.025, OR=1.756, 95% CI: 1.072-2.875) as well as in DH group (Χ(2)=6.168, P=0.013, OR=2.06, 95% CI: 1.161-3.663) than in the control group. There was no significant differences in the genotype frequency or allele distribution in other paired groups (P>0.05). Compared with Ff + ff genotype, FF genotype was associated with a significantly decreased average diastolic blood pressure (P=0.039) but significantly increased postprandial blood glucose (P=0.035), triglycerides (P=0.049) and uric acid (P=0.031). No significant difference was detected in genotype frequency or allele distribution of Bsm I polymorphisms between the groups (P>0.05); serum creatinine levels were significantly higher in bb genotype than in BB + Bb genotype group (P=0.011).
CONCLUSIONVDR gene Fok I polymorphisms may be a risk factor for dyslipidemia in elderly male patients with type 2 diabetes among Chinese Han population, where Bsm I polymorphisms are not associated with diabetic dyslipdiemia.
Aged ; Alleles ; Blood Glucose ; Blood Pressure ; Case-Control Studies ; Diabetes Mellitus, Type 2 ; genetics ; Dyslipidemias ; genetics ; Ethnic Groups ; Genotype ; Humans ; Male ; Polymerase Chain Reaction ; Polymorphism, Restriction Fragment Length ; Receptors, Calcitriol ; genetics ; Risk Factors ; Triglycerides ; blood
9.A Novel Recombinant BCG Vaccine Encoding Eimeria tenella Rhomboid and Chicken IL-2 Induces Protective Immunity Against Coccidiosis.
Qiuyue WANG ; Lifeng CHEN ; Jianhua LI ; Jun ZHENG ; Ning CAI ; Pengtao GONG ; Shuhong LI ; He LI ; Xichen ZHANG
The Korean Journal of Parasitology 2014;52(3):251-256
A novel recombinant Bacille Calmette-Guerin (rBCG) vaccine co-expressed Eimeria tenella rhomboid and cytokine chicken IL-2 (chIL-2) was constructed, and its efficacy against E. tenella challenge was observed. The rhomboid gene of E. tenella and chIL-2 gene were subcloned into integrative expression vector pMV361, producing vaccines rBCG pMV361-rho and pMV361-rho-IL2. Animal experiment via intranasal and subcutaneous route in chickens was carried out to evaluate the immune efficacy of the vaccines. The results indicated that these rBCG vaccines could obviously alleviate cacal lesions and oocyst output. Intranasal immunization with pMV361-rho and pMV361-rho-IL2 elicited better protective immunity against E. tenella than subcutaneous immunization. Splenocytes from chickens immunized with either rBCG pMV361-rho and pMV361-rho-IL2 had increased CD4+ and CD8+ cell production. Our data indicate recombinant BCG is able to impart partial protection against E. tenella challenge and co-expression of cytokine with antigen was an effective strategy to improve vaccine immunity.
Adjuvants, Immunologic/genetics/*metabolism
;
Administration, Intranasal
;
Animals
;
Antigens, Protozoan/genetics/*immunology
;
BCG Vaccine/administration & dosage/*genetics
;
CD4-Positive T-Lymphocytes/immunology
;
CD8-Positive T-Lymphocytes/immunology
;
Chickens
;
Coccidiosis/*prevention & control
;
Disease Models, Animal
;
Drug Carriers/administration & dosage
;
Eimeria tenella/genetics/*immunology
;
Genetic Vectors
;
Injections, Subcutaneous
;
Interleukin-2/genetics/*metabolism
;
Protozoan Vaccines/administration & dosage/genetics/*immunology
;
Spleen/immunology
;
Vaccines, Synthetic/administration & dosage/genetics/immunology
10.Comparison of drug susceptibility of and drug resistance mutations in fluconazole-resistant Candida albicans strains from superficial and deep infections
Tiantian DING ; Baohong CUI ; Shuhong MI ; Yang ZHANG ; Hailin ZHENG ; Jihai SHI ; Weida LIU
Chinese Journal of Dermatology 2022;55(10):874-878
Objective:To compare the in vitro susceptibility of fluconazole-resistant Candida albicans strains from superficial and deep infections to 8 antifungal drugs, and to compare drug resistance mutations in these strains. Methods:According to the Clinical and Laboratory Standards Institute (CLSI) protocol M27-A4, 26 deep infection-derived and 33 superficial infection-derived drug-resistant Candida albicans strains were tested for in vitro susceptibility to 8 antifungal drugs (fluconazole, voriconazole, itraconazole, posaconazole, amphotericin B, fluorocytosine, terbinafine, and micafungin) alone or in combination. DNA was extracted from all drug-resistant strains, and mutations in 3 drug resistance genes, including ERG3, ERG11 and FUR1, were detected by PCR. Normally distributed measurement data with homogeneous variance were compared between two groups by using two-independent-sample t test, non-normally distributed measurement data with non-homogeneous variance were compared using Mann-Whitney U test, and enumeration data were compared using chi-square test. Results:The minimum inhibitory concentrations (MICs) of fluconazole, itraconazole, voriconazole, posaconazole and fluorocytosine all significantly differed between the superficial infection group and deep infection group (all P < 0.05) , while there was no significant difference in the MIC of amphotericin B or micafungin between the two groups (both P > 0.05) . The MIC of terbinafine was >64 μg/ml in 96.6% of the above strains, so could not be compared between groups. As combination drug susceptibility testing revealed, the combination of terbinafine with azoles (fluconazole, voriconazole, itraconazole or posaconazole) showed synergistic inhibitory effects against 15 Candida albicans strains (7 strains from deep infections, 8 strains from superficial infections) , with fractional inhibitory concentration (FIC) indices being 0.033 to 0.187; no marked synergistic effect was observed in the combinations between fluorocytosine and azoles, between fluorocytosine and amphotericin B, or between amphotericin B and fluconazole, with the FIC indices being 0.56 to 1.125. The missense mutation V351A in the ERG3 gene was identified in all the 33 (100%) superficial infection-derived strains, as well as in 13 (50%) deep infection-derived strains, and the mutation A353T in the ERG3 gene was identified in 4 (15%) deep infection-derived strains; as for the ERG11 gene, missense mutations identified in the superficial infection-derived strains included I437V (32 strains, 97%) , Y132H (23 strains, 70%) , T123I (16 strains, 48%) , K128T (6 strains, 18%) , D116E (5 strains, 15%) , A114S (4 strains, 12%) , E266D (2 strains, 6%) , G448E (2 strains, 6%) , and G465S (2 strains, 6%) , while missense mutations identified in the deep infection-derived strains included I437V (23 strains, 88%) , E266D (13 strains, 50%) , E260G (5 strains, 19%) , and V488I (4 strains, 15%) ; the missense mutation R101C in the FUR1 gene was identified in 11 (33%) superficial infection-derived strains, but not identified in deep infection-derived strains. Conclusion:The drug susceptibility and drug resistance mutations differed to some extent between superficial infection- and deep infection-derived fluconazole-resistant Candida albicans strains.