1.Effect of surgery for spontaneous subconjunctival orbital fat prolapse via bulbar conjunctiva under topical anesthesia
Zhe, ZHOU ; Rong-Rong, GE ; Jing, SHI ; Jia-Li, HU
International Eye Science 2016;16(10):1949-1951
AIM: To evaluate the clinical efficacy of surgery for spontaneous subconjunctival orbital fat prolapse via bulbar conjunctiva under topical anesthesia.
●METHODS: A total of 22 eyes of 11 patients received surgery for spontaneous subconjunctival orbital fat prolapse via bulbar conjunctiva under topical anesthesia were included. Objective and subjective duration of the operation, degree of cooperation during surgery, postoperative recovery, recurrence and complications were observed.
●RESULTS: In the process of surgery, patients without pain and being-cooperated were recorded in 17 eyes. The patients who occasionally felt slight pain, but within endurance after adding topical anesthesia once and the operation was completed successfully were recorded in 5 eyes ( the second eye surgery ) . The operation was successfully completed in all the patients. Compared the coordination degree during surgery of Gradel with GradeⅡ, the difference was statistically significant ( t=-3. 123, P<0. 01). All eyes were healed well after operation.
● CONCLUSION: The surgery for spontaneous subconjunctival orbital fat prolapse via bulbar conjunctiva under topical anesthesia can ensure satisfactory anesthetic effect and get better quality of operation. It′s a simple, safe and effective anesthesia method for spontaneous subconjunctival orbital fat prolapse.
2.Build of focal cerebral ischemia model in different varieties of mice with modification monofilament.
Qiang JIA ; Zuo-Rong SHI ; Hong-Jun YANG
China Journal of Chinese Materia Medica 2014;39(17):3367-3370
OBJECTIVETo establish a general method of focal cerebral ischemia model in different varieties of mice.
METHODEach group of healthy adult KM and C57BL/6 mice were randomly divided into control group (n = 10) and MCAO group (n = 10). The mice in MCAO group were applied in the preparation of the MCAO model by intraluminal occlusion using monofilament. Twenty-four hours after operation,the neurologic function was evaluated,middle cerebral artery blood flow was monitored and the infarction volume was calculated by TTC staining, to evaluate the reliability of the model.
RESULTIn the MCAO group, the base value of the cerebral blood flow down of KM and C57BL/6 mice respectively was (81.65 ± 4.59)%, (83.68 ± 6.25)%. The neurological deficit score respectively was (2.30 ± 0.82), (2.50 ± 0.80). TTC staining can clearly show the infarction area, and relatively stable, 24 hours of the survival rate of KM and C57BL/6 mice were 100% and 80% respectively.
CONCLUSIONThe key link is the optimization and improvement of monofilament, temperature, anesthesia and so on. The modified intraluminal occlusion of MCAO using monofilament is a kind of reliable and simple method to establish experimental cerebral ischemia model in mice.
Animals ; Blood Flow Velocity ; Brain ; blood supply ; pathology ; physiopathology ; Brain Ischemia ; complications ; physiopathology ; Cerebrovascular Circulation ; Disease Models, Animal ; Infarction, Middle Cerebral Artery ; complications ; physiopathology ; Male ; Mice, Inbred C57BL ; Middle Cerebral Artery ; pathology ; physiopathology ; surgery ; Nervous System Diseases ; etiology ; physiopathology ; Species Specificity
3.Effect of liposomal transfection of cyclin A antisense oligodeoxynucleotide (ASON) on HL-60 cell proliferation and apoptosis.
Jie MA ; Shi-rong XU ; Cun-rong JIA ; Jin-song JIA ; Yi WANG ; Cui-ying SHI ; Wan-tong SHI ; Yin-rong YAO ; Yong-rong LAI
Chinese Journal of Hematology 2003;24(6):304-307
OBJECTIVETo explore the effect of liposomal transfection of cyclin A antisense oligodeoxynucleotide (ASON) on HL-60 cell proliferation and apoptosis.
METHODSBy liposomal transfection, cyclin A ASON was co-cultured with HL-60 cells, the cell growth curve was determined by MTT assay and cell apoptosis electron-microscopy in situ cell apoptosis detection kit (POD), the protein and mRNA of cyclin A and bcl-2 were measured by FACS and RT-PCR, the role of cyclin A ASON in the development of leukemia was tested by the tumor formation in nude mice.
RESULTS(1) In the cyclin A ASON liposomal transfection group (group A), the proliferation of HL-60 cell was significantly inhibited as compared to those in cyclin A ASON group (group B) (68.9% vs 24.8%) (P < 0.01). (2) The expressions of cyclin A and bcl-2 of group A were significantly lower than those in the control group (1.1% vs 38.8%, P < 0.01; 21.9% vs 65.0%, P < 0.01, respectively), and the DNA ladder and apoptosis body was displayed. (3) In group A, the rate of tumor formation in nude mice was lower, the time for tumor formation was longer and the volume of tumor was smaller than those in control group.
CONCLUSIONLiposomal transfection of cyclin A ASON can inhibit in vitro proliferation of leukemia cells and induce in vivo apoptosis of the tumor cell, which might provide a new target for gene therapy.
Animals ; Apoptosis ; drug effects ; Cell Division ; drug effects ; Cyclin A ; genetics ; physiology ; Genetic Therapy ; HL-60 Cells ; Humans ; Leukemia ; therapy ; Liposomes ; Mice ; Mice, Inbred BALB C ; Oligonucleotides, Antisense ; pharmacology ; Transfection
4.Vascular-specific promoters and cis-regulatory elements.
Chinese Journal of Biotechnology 2003;19(2):131-135
Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant
;
genetics
;
physiology
;
Phenylalanine Ammonia-Lyase
;
genetics
;
Plant Proteins
;
genetics
;
Promoter Regions, Genetic
;
genetics
;
Regulatory Sequences, Nucleic Acid
;
genetics
5.Dynamic change of spectral-domain optical coherence tomography in rat retina during critical period plasticity
Ning, HUA ; Xiao-rong, LI ; Le-dong, ZHAO ; Song, LIN ; Bo-shi, LIU ; Jia-qin, YUAN
Chinese Journal of Experimental Ophthalmology 2011;29(4):323-327
Background Retinal development continues during the early postnatal period in mammals.Correct arrangement of layers and precise location of various cells in the retina are vital for forming normal visual function during critical period plasticity.Spectral-domain optical coherence tomography(SD-OCT)provides highquality in vivo retinal imaging and the possibility to measure retinal thickness longitudinally. Objective The present study was to investigate the changes of retinal thickness during critical period plasticity in rats. Methods In vivo consecutive scanning of retinal image was performed in 10 SPF Sprague-Dawley rats at postnatal day 14(P14),P18,P21,P24 and P42 with SD-OCT,and retinal histopathological examination was used to detect retinal morphologic changes at the same postnatal ages in 20 matched rats.The whole retinal thickness,the thickness from inner limiting membrane(ILM)to inner plexiform layer(IPL),the thickness of inner nuclear layer(INL)and the thickness from outer nuclear layer(ONL)to retinal pigment epithelium(RPE)were measured using Cirrus HD-OCT system and HMIAS-2000 Imaging System in retinal sections.The measurement parameters by Cirrus HD-OCT and those by hematoxylin-eosin staining were compared.The use of animals followed the Statement of National Institute of Health (USA). Results In vivo high-resolution images of rat retinas with SD-OCT compared well with histology,which enabled quantitative comparison of the SD-OCT and histological data during critical period plasticity in rats.From P14 to P42,the retinal thickness gradually decreased with the increase of rat ages(F=15.425,P=0.000),and so were the thickness from ILM to IPL,the thickness of INL and the thickness from ONL to RPE(F=3.973,P=0.007;F=17.529,P=0.000;F=7.038,P=0.000).The retinal thickness,thickness of INL.thickness from ONL to RPE measured by Cirrus HD-OCT were significantly correlated with those measured by retinal sections among P14,P18,P21,P24 and P42 rats(r=0.794,P=0.000;r=0.784,P=0.000;r=0.681,P=0.000). Conclusion SD-OCT is a demonstratably valuable technology to study the structure of retinas in rats.The retinal thickness is shown to reduce in thickness throughout the development of the retina during critical period plasticity due to the decrease in thickness of INL and the distance from the ONL to RPE,as illustrated by OCT scanning.
6.Effects of methotrexate enantiomers on ECV304 cell inhibition and its mechanisms
Lifang GUO ; Rong WANG ; Zhengping JIA ; Youqin SHI ; Hua XIE ; Juanhong ZHANG ; Xiaoyu WU
Chinese Pharmacological Bulletin 2010;26(2):213-216
Aim To investigate the effect of MTX(included(±)MTX,(+)MTX and(-)MTX)on the proliferation of ECV304 cells and to explore its mechanisms.Methods ECV304 cells were cultured.The cell proliferation was determined by MTT.The morphological changes were inspected by inverted microscope.Cell cycle phases were assayed by propidium iodide staining flow cytometry.Results ECV304 cells were treated with(+)MTX,(-)MTX and(±)MTX at 1~150 μmol·L~(-1) for 24,48,72 h.The results showed that the proliferation of ECV304 cells was significantly inhibited under different conditions.The order of the inhibited efficacy was(+)MTX>(±)MTX>(-)MTX.The morphology of ECV304 cells were changed by(+)MTX,(-)MTX and(±)MTX treatment,which included the cell shrinkage,chromatin condensation.After administration of 10 μmol·L~(-1) of(+)MTX,(-)MTX and(±)MTX for 48 h,the cell cycle phases were assayed by propidium iodide staining flow cytometry.The result showed DNA replication was interfered by(+)MTX,(-)MTX and(±)MTX treatment.Conclusions The proliferation of ECV304 cells has the chiral selective effects by(+)MTX and(-)MTX treatment,and the inhibition on ECV304 cells proliferation of(+)MTX is significantly stronger than that of (-)MTX.
7.miR-200c regulates migration of breast cancer cell BT549 by targeting Slug
Liting JIA ; Yuan TIAN ; Ying SHI ; Linlin ZHANG ; Xiaoqian YANG ; Shouhua RONG ; Yuchao ZHANG ; Jing LI
Chinese Journal of Immunology 2015;(3):304-307
Objective:To investigate the effect on the expression of Slug for the trasfection of miR-200c combined with the research on the ability of migration of breast cancer cell BT549.Methods:Chemically synthesized miR-200c mimic was trasfected into BT549 cells,which have high metastatic potential.The effect on the ability of migration of breast cancer cell BT549 for the transfection of miR-200c was analyzed by Transwell migration assay and Wound healing assay.The expression of Slug and E-cadherin mRNA was detected by Real-time PCR.The expression of Slug protein was detected by Western blot.Results:Transfection with miR-200c mimic significantly down-regulated the expression of Slug as compared with the control group (P<0.05).BT549 cell tranfected with miR-200c mimic had lower levels of migration capacity than cells in the control group (P<0.05).Conclusion:miR-200c inhibits Epithelial-mes-enchymal transition by suppressing Slug leading to down-regulation of migration capacity of breast cancer cell BT549.
8.Expression of cyclin A1 mRNA in patients with myelodysplastic syndrome and its clinical significance.
Journal of Experimental Hematology 2009;17(2):377-381
The purpose of this study was to evaluate the expression of cyclin A1 mRNA in patients with myelodysplastic syndrome (MDS) and its clinical significance. The expression of cyclin A1, cdk2 and p21(cip1) mRNA in the bone marrow from 56 patients with MDS and 10 normal control were measured by using reverse transcription polymerase chain reaction (RT-PCR) technique. The results indicated that the positive rate and the expression level of cyclin A1 in MDS patients (69.64%; 0.964 +/- 1.879) were significantly higher than those in normal control (0%; 0.012 +/- 0.014) (p < 0.01). Among de-novo MDS patients, the expression level of cyclin A1 mRNA in the MDS-RAEB group (1.895 +/- 1.769) was higher than that in MDS-RA group (0.629 +/- 1.583) (p < 0.01). The expression level of cyclin A1 mRNA in post-treatment group was significantly lower than that in prior-treatment group (p < 0.01). It is concluded that the mRNA expression of cyclin A1 in MDS patients is higher than that in normal control, the abnormal expression of cyclin A1 may be used as a prognostic marker in MDS patients.
Adolescent
;
Adult
;
Aged
;
Aged, 80 and over
;
Case-Control Studies
;
Cyclin A1
;
genetics
;
metabolism
;
Female
;
HL-60 Cells
;
Humans
;
K562 Cells
;
Male
;
Middle Aged
;
Myelodysplastic Syndromes
;
genetics
;
metabolism
;
RNA, Messenger
;
genetics
;
Reverse Transcriptase Polymerase Chain Reaction
;
Young Adult
9.Research on the antioxidant activity of metabolites from a sponge-derived fungus Alternaria sp. F49
Yu-shi CHEN ; Jia-rong LENG ; Shu-ting LIN ; Shao-yun WANG ; Yong-qi TIAN
Acta Pharmaceutica Sinica 2022;57(7):2120-2125
To study the chemical constituents from the the deep-sea fungus
10.Overview of Pharmacological Research on Eggshell Membrane
Jiang GONG ; Shi-feng NI ; Xue-mei ZHANG ; Jia QU ; Rong-fang LUO ; Zhi-xuan LI ;
International Journal of Traditional Chinese Medicine 2009;31(2):187-188
In the basis of a large amount of literatures, this article sumed up the characteristics and application of eggshell membrane.