1.The mechanism of chlorogenic acid against neuropathic pain induced by cisplatin
Acta Pharmaceutica Sinica 2024;59(3):616-620
This study aimed to investigate the analgesic effect of chlorogenic acid on cisplatin-induced neuropathic pain and explored the underlying molecular mechanisms. The animal experimental protocol has been reviewed and approved by Laboratory Animal Ethics Committee of Xinxiang Central Hospital, in compliance with the Institutional Animal Care Guidelines. Von Frey hair and a radiant heat was employed to measure mechanical allodynia and thermal hyperalgesia; Western blot was used to examine transient receptor potential vanilloid type-1 (TRPV1) protein expression in the rat dorsal root ganglion (DRG); patch clamp was used to record TRPV1 currents in DRG neurons. The experimental results showed that chlorogenic acid could attenuate cisplatin-induce mechanical allodynia and thermal hyperalgesia in rats. The expression of TRPV1 protein in DRGs was increased in cisplatin-treated rats, while chlorogenic acid also could reverse cisplatin-induced the upregulation of TRPV1 protein. Forthermore, chlorogenic acid could attenuate cisplatin-mediated the upregulation of TRPV1 current density. These above results indicated that chlorogenic acid could alleviate cisplatin-induced pain hypersensitivity through inhibition of the expression and function of TRPV1 in rats.
2.Efficacy and safety of tyrosine kinase inhibitors in the treatment of HER2-positive breast cancer:a meta-analysis
Yinxue XU ; Xiaolan SHEN ; Xiufen LU ; Xuehui ZHANG
China Pharmacy 2024;35(3):361-367
OBJECTIVE To evaluate the efficacy and safety of tyrosine kinase inhibitors (TKI) in the treatment of HER2- positive breast cancer in order to provide evidence-based evidence for clinical medication. METHODS Retrieved from CNKI, Wanfang database, VIP, PubMed, Cochrane Library, Embase and Web of Science, randomized controlled trial (RCT) about TKI (trial group) versus drugs excluding TKI (control group) in the treatment of HER2-positive breast cancer were collected from the establishment of the database to April 2023. Meta-analysis and sensitivity analysis were performed by using RevMan 5.4.1 and Stata 17 software. RESULTS Total of 24 RCT studies were included, involving 15 538 HER2-positive breast cancer patients. The meta- analysis results showed that compared with the control group, the progression-free survival (PFS) [HR=0.91, 95%CI (0.80, 1.02), P=0.12], overall survival (OS) [HR=0.95, 95%CI (0.89, 1.01), P=0.11], objective response rate (ORR) [OR=1.21, 95%CI (0.86, 1.69), P=0.27], and pathological complete response rate (pCR) [OR=1.44, 95%CI (0.91, 2.27), P=0.12] had no statistically significant difference in the trial group; among the 3/4 grade ADRs, the trial group had a higher incidence of anemia [OR=1.77, 95%CI (1.16,2.70), P=0.008], rash [OR=11.26, 95%CI (7.32,17.31), P<0.000 01], paronychia [OR=8.67, 95%CI(1.62,46.53), P=0.01], diarrhea [OR=10.17, 95%CI(5.03,20.58), P<0.000 01], oral mucositis inflammation [OR= 9.34, 95%CI (3.13, 27.83), P<0.000 1], elevated aspartate aminotransferase [OR=2.09, 95%CI (1.13,3.84), P=0.02], and hypokalemia [OR=2.37, 95%CI (1.31,4.30), P=0.005] than that of the control group. Subgroup analysis results showed that compared with the placebo group, TKI could improve OS and ORR (P<0.05), while compared with trastuzumab, TKI had no advantage in PFS, OS, ORR, and pCR, and TKI combined with trastuzumab could significantly improve PFS, OS, ORR, and pCR compared with the trastuzumab group (P< 0.05). Sensitivity analysis suggested that the results were relatively robust and the risk of publication bias was low. CONCLUSIONS Compared with trastuzumab, TKI has no advantages in PFS, OS, ORR and pCR in the treatment of HER2- positive breast cancer, but TKI combined with trastuzumab can significantly improve PFS, OS, ORR and pCR; TKI can increase the risk of grade 3/4 anemia, rash, paronychia, diarrhea, oral mucositis, elevated aspartate aminotransferase, and hypokalemia.
3.Efficacy and safety of antibody-drug conjugates in the treatment of breast cancer:a meta-analysis
Yinxue XU ; Lei ZHANG ; Xiwen QIAO ; Xiaolan SHEN ; Qian SHEN ; Xuehui ZHANG
China Pharmacy 2023;34(20):2540-2544
OBJECTIVE To evaluate the efficacy and safety of antibody-drug conjugates (ADC) in the treatment of breast cancer, so as to provide an evidence-based reference for clinical medication. METHODS Retrieved from CNKI, Wanfang database, VIP, PubMed, the Cochrane Library, Embase, and Web of Science, randomized controlled trials (RCTs) about trastuzumab emtansine, trastuzumab deruxtecan and sacituzumab govitecan (trial group) versus chemotherapy or other anti-tumor drugs (control group), were collected during the inception to April 2023. After screening the literature, extracting data, and evaluating the quality of the literature, a meta-analysis was conducted by using RevMan 5.4.1 software. RESULTS A total of 8 RCTs were included, with a total of 5 577 patients. The results of the meta-analysis showed that the progression-free survival (PFS) [HR=0.76, 95%CI (0.69, 0.83), P<0.000 01], overall survival (OS) [HR=0.87, 95%CI (0.81, 0.93), P<0.000 1], and clinical benefit rate (CBR) [OR=2.70, 95%CI (1.15, 6.33), P=0.02] of the trial group were significantly higher than control group. There was no statistically significant difference in objective response rate (ORR) between the two groups [OR=2.34, 95%CI (0.59, 9.33), P=0.23]. The results of subgroup analysis showed that the PFS of HER2-positive patients and HER2-negative patients, and the OS of HER2-positive patients in the trial group were significantly higher than control group (P<0.05). The incidence of anemia and increase of aspartic acid transaminase (AST) in the trial group was significantly higher than control group (P<0.05). The results of sensitivity analysis showed that the results obtained with PFS, OS, and ORR as indicators were relatively robust, while the results obtained with CBR as indicators lacked robustness. CONCLUSIONS ADC drugs have significant effects on breast cancer, but will increase the risk of anemia and elevated AST.
4.Correlation analysis of lipid metabolism disorder of third trimester and retinopathy of prematurity in premature infants
International Eye Science 2022;22(1):135-138
AIM: To investigate the correlation between lipid metabolism disorder and retinopathy of prematurity(ROP)of premature infants.
METHODS: A retrospective analysis was performed on the medical data of 48 premature infants mothers who were hospitalized and diagnosed with ROP in the Department of Neonatology, Children's Hospital of Soochow University from January 2017 to December 2018. Forty-eight hospitalized no-rop premature infants mothers were enrolled as the control group during the same period. The two groups were compared in terms of blood lipids and adiponectin level in the third trimester. Pearson correlation and Logistic regression analysis were used to analyze the correlation between adiponectin and blood lipids and risk factors of retinopathy in premature infants.
RESULTS: The total cholesterol, triglyceride, low-density lipoprotein and apolipoprotein B level in the observation group were all higher than those in the control group, while high-density lipoprotein, adiponectin and apolipoprotein A1 level were lower than those in the control group. In addition, Pearson correlation analysis showed correlation between adiponectin and blood lipid levels, while Logistic regression analysis showed increased of total cholesterol, triglycerides, low-density lipoprotein, and apolipoprotein B and decreased of high-density lipoprotein, and apolipoprotein A1 were risk factors for ROP.
CONCLUSION: Pearson test indicated positive correlation between lipid disorders of third trimester and retinopathy of premature infants, which may be related to adiponectin. In clinical work, we should focus on strengthening the guidance of maternal nutrition to reduce the incidence of ROP.
5.Modulatory Potential of LncRNA Zfas1for Inflammation and Neuronal Apoptosis in Temporal Lobe Epilepsy
Chuan HE ; Caixia SU ; Wentong ZHANG ; Qin ZHOU ; Xu SHEN ; Junjie YANG ; Naixian SHI
Yonsei Medical Journal 2021;62(3):215-223
Purpose:
This study aimed to elucidate whether lncRNA ZFAS1 is involved in neuronal apoptosis and inflammation in temporal lobe epilepsy (TLE).
Materials and Methods:
Ninety-six TLE patients were recruited, and their peripheral venous blood was gathered to determine Zfas1 expression with polymerase chain reaction. Neurons were separated from hippocampal tissue of newborn SD rats, and siZfas1 or pcDNA3.1-Zfas1 was transfected into the neurons. Inflammatory cytokines released by neurons were determined, and neuronal activities were evaluated through MTT assay, colony formation assay, and flow cytometry.
Results:
Serum levels of Zfas1 were higher in TLE patients than in healthy controls (p<0.05). Furthermore, Zfas1 expression in neurons was raised by pcDNA3.1-Zfas1 and declined after silencing of Zfas1 (p<0.05). Transfection of pcDNA-Zfas1 weakened the viability and proliferation of neurons and increased neuronal apoptosis (p<0.05). Meanwhile, pcDNA3.1-Zfas1 transfection promoted lipopolysaccharide-induced release of cytokines, including tumor necrosis factor-α, interleukin (IL)-1, IL-6, and intercellular adhesion molecule-1 (p<0.05), and boosted NF-κB activation by elevating the expression of NF-κB p65, pIκBα, and IKKβ in neurons (p<0.05).
Conclusion
Our results indicated that lncRNA ZFAS1 exacerbates epilepsy development by promoting neuronal apoptosis and inflammation, implying ZFAS1 as a promising treatment target for epilepsy.
6. The research on hyperthyroidism cardiovascular diseases
Zhenhua LU ; Yongxiang MA ; Jing ZHANG ; Lijian NIU ; Fei YU ; Liping MIAO ; Wenjun HUANG
Journal of Chinese Physician 2019;21(10):1588-1591
Hyperthyroidism is a clinically common endocrine disease. It often has no specific clinical symptoms in the early stage and is easily overlooked. The long-term effects of excessive thyroid hormones in the body can alter cardiovascular hemodynamics, which may lead to heart enlargement, atrial fibrillation, and heart failure. Cardiovascular disease is one of the common complications of hyperthyroidism, but it is the main cause of death. This article focuses on the related cardiovascular diseases of hyperthyroidism, and summarizes the molecular mechanism of thyroid hormone on the heart, the mechanism of hyperthyroidism induced heart failure, atrial fibrillation, pulmonary hypertension, and the treatment and prognosis of hyperthyroidism. In addition, we also analyzed the association between subclinical hyperthyroidism and the occurrence of cardiovascular disease. When combined with risk factors, subclinical hyperthyroidism patients need early treatment. It should be noted that long-term use of amiodarone can cause secondary hyperthyroidism, which should be used with caution in clinical use.
7.Analysis of NF2 gene mutations in intraspinal Schwannomas.
Shuyi LIU ; Shi CHEN ; Kaichuang ZHANG ; Jian LIN ; Qingwu YANG ; Yongliang ZHANG ; Shuiyuan LIU ; Shengze LIU
Chinese Journal of Medical Genetics 2017;34(5):637-641
OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.
METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.
CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.
Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics
8.Question Answering System Based on the Big Data of Electronic Medical Records (EMR)
Shengze ZHANG ; Qingyang WANG ; Kehong YUAN
Journal of Medical Informatics 2017;38(3):7-11,39
Based on the big data of Electronic Medical Records (EMR),information retrieval and the deep learning method,an auxiliary diagnosis Question Answering (QA) system is designed.The paper introduces the design of general framework,EMR database,value network and policy-based network of the system,provides the system operation process.This system can not only help patients to examine their conditions independently,but also provide reference for doctors when they make the diagnosis and treatment schemes.
9.Effect of levocarnitine and trimetazidine on left ventricular mass index in patients with MHD
Yuan ZHU ; Jianke XIA ; Xiaoshuang ZHANG ; Shengze ZHANG ; Shaoshao DONG
Chinese Journal of Primary Medicine and Pharmacy 2016;23(12):1867-1870,1871
Objective To observe the effect of levocarnitine and trimetazidine on left ventricular mass index in patients with maintenance hemodialysis (MHD),and to explore the safety and efficacy of the two drugs when used in combination.Methods 48 cases of MHD were randomly divided into control group and treatment group,24 cases in each group.On the basis of routine treatment,treatment group was treated with L -carnitine 1.0g by intravenous, 3 times per week,and trimetazidine tablets 20mg,3 times daily at the end of each dialysis.The control group was only treated with L -carnitine.The course of treatment was 12 months.The left atrial diameter (LAD),left ventricular end diastolic diameter (LVDD),left ventricular end diameter (LVDS),interventricular septal thickness (IvST),left ventricular posterior wall thickness (LVPWt),left ventricular ejection fraction (LVEF),stroke volume (SV),left ventricular mass index calculation were detected and compared before and after treatment in the two groups.Results After treatment,the LAD,LVDd,LVDs,IvST,LVPWt in the control group were (40.25 ±1.73)mm,(51.16 ± 3.17)mm,(32.52 ±2.86)mm,(11.16 ±1.23)mm,(10.23 ±1.19)mm,which were decreased compared with before treatment [(42.63 ±1.82)mm,(53.71 ±3.26)mm,(35.83 ±3.12)mm,(12.51 ±1.39)mm,(11.76 ± 1.37)mm],and the LAD,LVDd,LVDs,IvST,LVPWt in the treatment group were (37.61 ±1.86)mm,(47.53 ± 3.18)mm,(29.71 ±2.93)mm,(10.46 ±1.32)mm,(9.14 ±1.32)mm,which were decreased compared with beforetreatment [(42.89 ±1.91 )mm,(54.18 ±3.29)mm,(35.76 ±3.27)mm,(12.49 ±1.35 )mm,(11.73 ± 1.41)mm](t control group =4.643,2.747,3.831,3.563,4.130,t treatment group =9.702,7.120,6.750,5.209, 6.569,all P <0.05 ),and each index of the treatment group was significantly lower than the control group (t =5.091,3.961,3.362,2.901,3.005,all P <0.05 ).The LVMI of the control group and treatment group was (121.63 ±7.16)g/m2 ,(115.49 ±7.91)g/m2 after treatment,which were decreased compared with before treatment [(127.32 ±7.51)g/m2,(126.87 ±7.28)g/m2 ](t =2.686,5.186,all P <0.05).The EF and SV of the control group were (58.16 ±4.35)%,(43.61 ±4.72)mL after treatment,which were increased compared with before treat-ment[(55.32 ±4.17)%,(40.52 ±4.13)mL](t =2.686,5.186,all P <0.05).The EF and SV of the treatment group were (61.26 ±4.13)%,(46.25 ±4.17)mL after treatment,which were increased compared with before treat-ment[(55.28 ±4.51)%,(40.81 ±4.96)mL](t =4.791,4.113,all P <0.05).After treatment,LVMI in the treat-ment group was lower than that in the control group,SV and EF were higher than those in the control group (t =2.819,2.532,2.053,all P <0.05).Conclusion Compared with single levocarnitine,the therapy of levocarnitine and trimetazidine can better reduce left ventricular mass index in MHD patients and improve the cardiac structure and function,which is safe and effective.
10.Expression and significances of Merlin and mTOR in spinal schwannoma
Shengze LIU ; Kaichuang ZHANG ; Yongliang ZHANG ; Jian LIN ; Shi CHEN
Cancer Research and Clinic 2015;27(4):253-255
Objective To clarify the expression and clinicopathological significances of mTOR and Merlin proteins in spinal schwannoma.Methods Immunohistochemical SP method was used to detect the expression levels of mTOR and Merlin proteins in tumor tissues from 21 spinal schwannoma patients.The meaning of the two proteins expression changes on schwannoma was analyzed.Results In 21 cases of schwannoma patients,the mTOR was positive expression in 16 cases,negative expression in 5 cases,while in the normal neural tissue,mTOR was all negative expression.In 21 cases of schwannoma patients,the Merlin protein was negative expression in 18 cases,positive expression in 3 cases,but it was positive in all of normal neural tissue.Merlin protein expression was negatively correlated with mTOR protein expression (r =-0.785,P < 0.001).Conclusion The expression level of mTOR proteins in schwannoma is significantly higher than that in normal nerve tissue,while the expression level of Merlin protein in schwannoma tissue is significantly lower than that in normal nerve tissue.There is an internal relationship between mTOR and Merlin.

Result Analysis
Print
Save
E-mail