1.Exploration of muscle mass index and its association with cardiovascular risk factors among adolescents in Xinjiang s agricultural and pastoral areas
ZHAO Yali, LIU Weichen, LIU Shengze, Alimujiang
Chinese Journal of School Health 2025;46(4):588-591
Objective:
To explore the muscle mass index (MMI) among adolescents in Xinjiangs agricultural and pastoral areas and its association with cardiovascular risk factors, providing references and basis for the prevention and intervention of cardiovascular diseases among adolescents in these regions.
Methods:
From March to July 2023, a total of 1 842 students aged 13-18 years from four middle schools in Yili agricultural and pastoral areas of Xinjiang were selected using cluster random sampling. Measurements of muscle mass, physical indicators, questionnaires, and blood samples were conducted and analyzed. Statistical analyses were performed using oneway analysis of variance, Kruskal-Wallis H test, Mann-Whitney U test, and Logistic regression analysis.
Results:
There were significant differences in weight,body mass index (BMI),waist circumference,muscle mass,systolic blood pressure,diastolic blood pressure,total cholesterol,highdensity lipoprotein cholesterol and fasting blood glucose among adolescents with severe, insufficient, good, and sufficient MMI in Xinjiangs agricultural and pastoral areas(F=326.78,634.76,261.67,134.56,80.14,16.78,5.84,21.67,3.42,P<0.01). Logistic regression analysis showed that, after adjusting age and BMI, the risk of cardiovascular risk factors aggregation in adolescents with good (OR=0.55-0.62) and adequate (OR=0.52-0.57) MMI were lower than that in adolescents with insufficient MMI (P<0.05). After gender stratification, the risk of cardiovascular risk factors aggregation in adolescents with good MMI for boys (OR=0.48-0.62) and with good MMI for girls (OR=0.61) were also lower than that in adolescents with insufficient MMI (P<0.05).
Conclusions
MMI in adolescents from agricultural and pastoral areas of Xinjiang are positively correlated with cardiovascular health. Future efforts should focus on muscle strength training for adolescents in these areas, as improving MMI can play a positive role in promoting cardiovascular health in adolescents.
2.Effect of nerve growth factor-beta on proliferation of intraspinal schwannomas
Deping CHEN ; Shengze LIU ; Shi CHEN ; Changchun CONG ; Shuyi LIU ; Ying XIAO
Chinese Journal of Tissue Engineering Research 2019;23(15):2373-2379
BACKGROUND: Existing evidence has shown that that the effect of NGF/TrkA signaling pathway on proliferation and differentiation of tumor cells is closely related to PI3 K/AKT signaling pathway in human benign and malignant tumors. However, there is little information on the NGF/TrkA signaling pathway in pathogenesis of intraspinal schwannomas. OBJECTIVE: To investigate the effect of nerve growth factor-beta on the proliferation of interspinal schwannoma cells and to explore on the pathogenesis of NGF/TrkA signaling pathway in interspinal schwannoma. METHODS: Tumor samples were collected and digested to obtain high purity tumor cells as experimental cells. Then the cells were given different concentrations of nerve growth factor-beta (15, 30, 60, 120 and 240 μg/L), K252 a (100, 200, 300, 400, 500 and 600 nmol/L), LY294002 (10, 20, 30, 40, 50 and 60 μmol/L), nerve growth factor-beta (120 μg/L) plus K252 a (TrkA inhibitor, 400 nmol/L), and nerve growth factor-beta (120 μg/L) plus LY294002 (P13 K inhibitor, 50 μmol/L), respectively, for a certain time. The cell proliferation was detected by MTT assay. TrkA, AKT, p-AKT (Ther308), p-GSK-3 beta protein expression was detected by western blot assay. TrkA and AKT mRNA expression was detected by RT-PCR. RESULTS AND CONCLUSION: (1) Compared with the control group, the absorbance value of cells in the nerve growth factor-beta groups was increased in a concentration-dependent manner (P < 0.05), and increased obviously at the concentration of 120 μg/L (P < 0.001). The absorbance value of cells in the K252 a and LY294002 groups was decreased continuously (P < 0.05), and decreased obviously at the concentration of 400 nmol/L and 50 μmol/L, respectively (P< 0.001). (2) The expression levels of TrkA, p-AKT (Ther308), and p-GSK-3 beta protein were upregulated in the nerve growth factor-beta group (P < 0.05), and the expression level of TrkA mRNA was upregulated (P < 0.05). (3) In the nerve growth factor-beta (120 μg/L) plus K252 a (400 nmol/L) group, the absorbance value of cells decreased (P < 0.001). The expression levels of TrkA, p-AKT (Ther308), and p-GSK-3 beta protein downregulated (P < 0.05), and the expression level of TrkA mRNA downregulated (P < 0.05). (4) In the nerve growth factor-beta (120 μg/L) plus LY294002 (50 μmol/L) group, the absorbance value of cells decreased (P < 0.01), and the expression levels of p-AKT (Ther308), and p-GSK-3 beta protein downregulated (P < 0.05). (5) There was no significant change in AKT protein and mRNA in each group (P> 0.05). (6) These results suggest that nerve growth factor-beta can promote interspinal schwannoma cell proliferation, which may be related to the expression of TrkA, p-AKT (Ther308) and p-GSK-3 beta protein in NGF/TrkA signaling pathway.
3. Analysis of the effect of different chest drainage after uniportal video-assisted thoracoscopic radical operation for lung cancer
Wuxin LIU ; Haitao MA ; Haitao HUANG
Chinese Journal of Thoracic and Cardiovascular Surgery 2019;35(9):515-519
Objective:
To investigate the effect of different thoracicdrainage methods afte single holethoracoscopicsurgery for lung cancer.
Methods:
200 patents with lung cancer undergoing single holethoracoscopicsurgery were divided into two groups : group A and group B in the first affliliated Hospital of Suzhou University from April 2014 to December 2016. Group A: 100 patients with 30#single thoracic drainage tube after operation. Groupe B: 100 patients with 30#thoracic drainage tube plus a negative pressure drainage tube after operation. The amount of thoracic drainage tube , drainage time , postoperative chest puncture, postoperative pain, hospital stay and total costs of hospitalization were observed in both groups.
Results:
There was no difference in age, sex, pathological type and pulmonary lobectomy between the two groups. Total thoracic drainage[(1 007.4±512.95)ml vs.(982.35±359.93)ml]and totaltube time[(5.71±2.61)days vs.(5.43±1.91) days] had no significant difference between the two groups. There was a significant difference in the length of 30#thoracic drainage tube [(5.71±2.61)days vs.(2.9±0.61)days]between the two groups. The difference of hospitalization time[(12.05±2.93)days vs.(13.45±4.15)days]and hospitalization expenses[(63 376.47±1 615.82)yuan vs.(64 449.82±3 650.04)yuan]was statistically significant. The rate of rethoracotomy in gruop A was 7%, the rate of rethoracotomy in group B was 0, the comparison between the two groups was statistically significant. VAS pain scores were compared on the first day and the second day, there was no significant difference on the third day after operation. On the fifth day after operation, the difference was statistically significant.
Conclusion
Adding a negative pressure drainage tube on the basis of using a single thoracoscopic drainage tube for radical resection of lung cancer after single hole thoracoscopic surgery will not increase postoperative pain of patients, significantly shorten postoperative hospitalization time, effectively control postoperativerethoracopunchure rate, thus effectively reduce postoperative hospitalization costs of patients.
4.Application and research progress of human papillomavirus vaccine
Journal of International Oncology 2018;45(2):112-114
The human papillomavirus (HPV) is the most common sexually transmitted virus.HPV vaccine to prevent HPV infection has become a primary preventive measure for cervical cancer and has been applied in many countries and regions around the world.The application of therapeutic HPV vaccine has become a hot point in the research of HPV.
5.Experimental research of miR-132 inhibits proliferation and induces apoptosis of ovarian cancer via Ezrin
Bo YANG ; Shengze LI ; Ling MA ; Suyang GUO ; Hongli LIU ; Jian LIU ; Junjun SHAO
Chinese Journal of Immunology 2017;33(1):72-75,80
Objective:To explore the biological function of miR-132 in ovarian cancer and the target. Methods: 22 cases ovarian cancer tissue and non-tumor tissue adjacent were collected,the expression of miR-132 in tumor tissue and non-tumor tissue, normal ovarian epithelial cells and ovarian cancer cell were detected by RT-PCR. The normal ovarian epithelial cells which the expression of miR-132 maximum or minimum were chosen, and they were divided into two groups, respectively with transfection of negative control plasmid ( NC) and miR-132 mimic plasmid. The expression of miR-132 after transfection was detected by RT-PCR,the cell proliferation and cell apoptosis were detected by CCK-8 method and flow cytometry instrument respectively,the expression of Ezrin protein was detected by Western blot. Results:The expression of miR-132 in tumor tissue was significantly lower than the tumor tissue adjacent,the expression of miR-132 in ovarian cancer cell lines was significantly lower than normal ovarian epithelial cells, the differences were statistically significant (P<0. 05). The SKOV3 cell lines was chosed for gene transfection,compared with NC group, transfection with miR-132 mimic plasmid could significantly reduce cell proliferation, increase cell apoptosis, the difference had statistical significance ( P<0. 05 ) . Western blot results showed that up-regulation miR-132 significantly increased the Ezrin protein expression in ovarian cancer SKOV3 cells ( P<0. 05 ) . Conclusion: In ovarian cancer, miR-132;inhibits proliferation and induces apoptosis of ovarian cancer via Ezrin,it may be a tumor suppressor gene.
6.Analysis of NF2 gene mutations in intraspinal Schwannomas.
Shuyi LIU ; Shi CHEN ; Kaichuang ZHANG ; Jian LIN ; Qingwu YANG ; Yongliang ZHANG ; Shuiyuan LIU ; Shengze LIU
Chinese Journal of Medical Genetics 2017;34(5):637-641
OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.
METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.
CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.
Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics
7.Inhibiting HSP70 expression enhances cisplatin sensitivity of cervical cancer cells
Jian LIU ; Jing LIU ; Shengze LI ; Yingao ZHENG ; Suyang GUO ; Xiu WANG
Journal of Southern Medical University 2017;37(4):475-481
Objective To investigate the relationship between sensitivity to cisplatin (DDP) and the expression of HSP70 in cervical cancer cells in vitro. Methods Cervical cancer Hela229 cells treated with different concentrations of DDP and the HSP70 inhibitor (PFT-μ) were examined for cell viability using MTT assay and colony forming ability. The cell apoptosis was analyzed by flow cytometry with propidium iodide staining and DAPI staining, and JC-1 staining was used to determine mitochondrial membrane potential. The expressions of HSP70, Bcl-2, Bax and caspase-3 were measured with Western blotting. A nude mouse model bearing Hela229 cell xenograft was used to evaluate the effect of DDP and PFT-μ on tumor growth. Results Hela229 cells expressed a higher level of HSP70 than normal cervical cells. The combined use of PFT-μ significantly enhanced the inhibitory effect of DDP (P<0.01) and increased the cell apoptosis in Hela229 cells. JC-1 staining demonstrated that DDP combined with PFT-μmore obviously reduced mitochondrial membrane potential. DDP combined with PFT-μmore strongly lowered Bcl-2 expression and increased the expressions of casepase-3 and Bax than DDP alone. In the nude mouse model, PFT-μ significantly enhanced DDP sensitivity of Hela229 cell xenografts (P<0.01). Conclusions Inhibition of HSP70 expression can enhance the sensitivity of cervical cancer cell to DDP both in vivo and in vitro possibly by promoting cell apoptosis, suggesting the potential of HSP70 as a new target for gene therapy of cervical cancer.
8.Inhibiting HSP70 expression enhances cisplatin sensitivity of cervical cancer cells
Jian LIU ; Jing LIU ; Shengze LI ; Yingao ZHENG ; Suyang GUO ; Xiu WANG
Journal of Southern Medical University 2017;37(4):475-481
Objective To investigate the relationship between sensitivity to cisplatin (DDP) and the expression of HSP70 in cervical cancer cells in vitro. Methods Cervical cancer Hela229 cells treated with different concentrations of DDP and the HSP70 inhibitor (PFT-μ) were examined for cell viability using MTT assay and colony forming ability. The cell apoptosis was analyzed by flow cytometry with propidium iodide staining and DAPI staining, and JC-1 staining was used to determine mitochondrial membrane potential. The expressions of HSP70, Bcl-2, Bax and caspase-3 were measured with Western blotting. A nude mouse model bearing Hela229 cell xenograft was used to evaluate the effect of DDP and PFT-μ on tumor growth. Results Hela229 cells expressed a higher level of HSP70 than normal cervical cells. The combined use of PFT-μ significantly enhanced the inhibitory effect of DDP (P<0.01) and increased the cell apoptosis in Hela229 cells. JC-1 staining demonstrated that DDP combined with PFT-μmore obviously reduced mitochondrial membrane potential. DDP combined with PFT-μmore strongly lowered Bcl-2 expression and increased the expressions of casepase-3 and Bax than DDP alone. In the nude mouse model, PFT-μ significantly enhanced DDP sensitivity of Hela229 cell xenografts (P<0.01). Conclusions Inhibition of HSP70 expression can enhance the sensitivity of cervical cancer cell to DDP both in vivo and in vitro possibly by promoting cell apoptosis, suggesting the potential of HSP70 as a new target for gene therapy of cervical cancer.
9.Analysis of prognostic factors in patients with stageⅠB2-ⅡA2 uterine cervical cancer treated with a combintion of neoadjuvant chemotherapy and surgery
Jian LIU ; Yanyan CUI ; Shengze LI ; Ling MA ; Qun LI ; Yuzhi LI ; Suyang GUO ; Jingbo LIU
China Oncology 2016;26(5):427-433
Background and purpose:The aim of this study was to analyze the prognostic factors in uterine adenocarcinoma and adenosquamous carcinoma treated with a combination of neoadjuvant chemoradiotherapy and surgery.Methods:Clinicopathologic data from 50 patients with stageⅠB2-ⅡA2 uterine cervical cancer were collected from the First Afifliated Hospital of Bengbu Medical College between Apr. 2005 and Oct. 2011. All patients underwent neoajuvant chemoradiotherapy, followed by radical hysterectomy and pelvic lymph node dissection. Before surgery, an intravenous chemotherapy was given. A particular vaginal brachytherapy was given to those with tumor diameter≥6 cm. The survival and recurrence in patients were analyzed retrospectively to investigate the prognostic factors. Results:In 50 patients withⅠB2-ⅡA2 uterine adenocarcinoma and adenosquamous carcinoma, 15 died during the follow-up period. The 2-year and 5-year progression-free survival rates were 80.12% and 72.24%, respectively, and median progression-free survival was 68 months. The 2-year and 5-year overall survival rates were 95.38% and 73.56%, respectively, and median overall survival was 80 months. Univariate analysis revealed that pelvic lymph node metastasis, cervical stromal invasion, parametrial infiltration, tumor diameter reduction <3 cm and advanced stage were the prognostic factors in patients with cervical cancer (P<0.05). Age, postoperative radiochemotherapy, lymphatic clearance involvement, FIGO stage, preservation of ovary and pathologic type were not associated with prognosis (P>0.05). Multivariate Cox proportional analysis revealed that pelvic lymph node metastasis and tumor diameter reduction after radiation and chemotherapy were the independent prognostic factors in patients with cervical cancer. Conclusion:The combination of neoadjuvant chemotherapy and surgery improves the resectable rate of patients withⅠB2-ⅡA2 uterine adenocarcinoma and adenosquamous carcinoma. Pelvic lymph node metastasis and tumor diameter reduction after radiation and chemotherapy are the independent prognostic factors in patients with cervical cancer.
10.Peripheral blood T lymphocytes cell level of different grades of cerebral gliomas patients before and after operation and its clinical significance
Chunhua XU ; Yue LIU ; Limin XIAO ; Shengze DENG ; Changgui GUO ; Erming ZENG ; Tao HONG
Chongqing Medicine 2016;(2):180-182
Objective To explore the peripheral blood T lymphocytes cell level in different grades of cerebral gliomas pa-tients at the time of before and after operation and its clinical significance .Methods A total of 80 cases of brain tumor patients from February 2010 to February 2012 in this hospital were chosed as study objects ,included 57 cases of glioma ,23 cases of other brain tumors ;57 cases of glioma were divided into 19 cases of low grade group and 38 cases of high grade group accorded to WHO grading standards ,and 50 cases of healthy people in same period were selected as control group .Venous blood in three groups were extracted at 1st day and 1st week after operation ,to detected the level of T lymphocyte subsets in peripheral blood and analyze the relationship between the different grade gliomas and prognosis .Results The peripheral blood CD3 + ,CD4 + ,CD4 + /CD8 + in control group were significantly higher than that of other brain tumor group and the glioma group ,CD8 + was significantly lower than that of the two groups(P< 0 .05) .Compared with other tumor group ,peripheral blood CD3 + ,CD4 + ,CD4 + /CD8 + in glioma group de-creased significantly ,CD8 + increased significantly(P< 0 .05) ;before and after the operation ,the CD3 + and CD4 + /CD8 + levels were significantly higher in low grade group than in the high grade group ,CD8 + was significantly lower in low grade group than in the high grade group(P< 0 .05) ,at the time of 1st week after operation ,CD3 + and CD4 + /CD8 + increased ,CD8 + decreased significant-ly of two groups when intra-group comparison (P < 0 .05) .The median survival time were 31 months in low grade group and 13 months in high grade group ,and the singnificance was found in two groups(P< 0 .05) .The median survival time were 34 months in CD4 + /CD8 + > 1 group and 17 months in CD4 + /CD8 + < 1 group ,the singnificance was found in two groups(P< 0 .05) .Conclusion The immune function of patients with brain glioma is inhibited ,the higher the malignancy of the tumor ,the more obvious of im-mune inhibition ;T lymphocyte subsets level could be used as evaluating index of malignant degree and prognosis of brain glioma .


Result Analysis
Print
Save
E-mail