1.Observation on the effect of calcium gluconate oral solution combined with psychological intervention on preventing the advertise reaction in blood donation by plateletpheresis
Haiyan LUO ; Fang FANG ; Shengnan LUO ; Dan YE
Chinese Journal of Biochemical Pharmaceutics 2017;37(7):308-309,312
Objective To study the effect of calcium gluconate oral solution combined with psychological intervention on preventing the advertise reaction in blood donation by plateletpheresis.Methods From February 2015 to February 2016, 114 cases were collected in Shaoxing downtown blood bank, and were divided into the control group and the experimental group 57 cases in each group.In the blood collection process, the control group were not given any treatment, the experimental group was given calcium gluconate oral liquid combined with psychological intervention.The total incidence adverse reactions and SAS scores in the two groups was compared.Results Before blood donation, Before blood donation, SAS scores in the two groups has no statistically significance.After blood donation, the SAS scores and the total incidence of adverse reactions in the experimental group were significantly lower than those in the control group, the differences in the two groups were statistically significant.(P<0.05).Conclusion Calcium gluconate oral liquid combined with psychological intervention can prevent the adverse reactions in the process of blood donation by plateletpheresis, which is worthy of promotion in the process of plateletpheresis.
3.Effect of meloxicam on CUMS-induced depressive-like behavior in rats and its preliminary mechanism
Shengnan KUANG ; Ying LUO ; Xiaoyan TIAN ; Lu ZHANG ; Yang YANG ; Junqing YANG
Chinese Pharmacological Bulletin 2016;(2):263-267,268
Aim To explore the effect of meloxicam on the CUMS-induced depressive-like behaviors in rats and its preliminary mechanism. Methods The rats were exposed to CUMS procedure for 6 weeks to estab-lish the model of depression. Meloxicam(1,3 mg· kg-1 ) and sertraline(5 mg·kg-1 ) were administered to rats from 22d of the stress procedure(once a day,for 21 days,p. o. ) . Depressive-like behaviors were evalu-ated by the open-field test and force swimming test. The levels of PGE2 and TNF-αin cortex were measured by ELISA. Moreover, the concentrations of NE, DA, DOPAC and 5-HIAA were also measured by HPLC, and the protein expression of 5-HT1 AR in cortex was analyzed by the immunohistochemistry. Results Com-pared with the rats of normal control group,the vertical and horizontal movement scores of rats in the open-field test were decreased and the immobility time in the forced swimming test was increased in model group. The levels of PGE2 and TNF-α were both increased signifi-cantly,whereas the concentrations of NE, DA, DOPAC and 5-HIAA were decreased and the expression of 5-HT1AR was reduced in cortex. Compared with the rats of model group, meloxicam significantly improved the depressive behaviors of rats in experimental groups and reversed the content of PGE2 ,TNF-α,NE,DA,DOPAC and 5-HIAA, as well as the expression of 5-HT1AR. Conclusion Meloxicam has a significant protective effect on CUMS-induced depressive-like behaviors, and the protective mechanism might be related to atten-uating inflammation response and reconstructing the balance of the monoamine neurotransmitter system in rat cortex.
4.Recombination of RegIII-proinsulin-pBudCE4.1 plasmid and its therapeutic effect on STZ-induced type 1 diabetes mellitus.
Wenrui HOU ; Shengnan XIE ; Jingli LU ; Wei XI ; Xiang LUO ; Ming XIANG
Acta Pharmaceutica Sinica 2010;45(8):987-94
The aim of this study is to investigate the therapeutic effect of RegIII-proinsulin-pBudCE4.1 plasmid on streptozotocin (STZ)-induced type 1 diabetes mellitus and its underlying mechanisms. The model of type 1 diabetes mellitus was established by intraperitoneal injections of STZ (40 mg kg(-1)) to Balb/c mice for five consecutive days. Then, ten type 1 diabetic mice were intramuscularly injected with 100 microg RegIII-proinsulin-pBudCE4.1 plasmid for 4 weeks (one time/week) and the blood glucose levels were monitored every week; whereas another ten diabetic mice served as negative control group were injected with pBudCE4.1 vector at the same dose. Normal control and model control mice were treated with normal saline at identical volume under the same way. Western blotting, MTT assay, ELISA, HE staining and Tunel assay were applied to explore the underlying mechanisms. Results showed that RegIII-proinsulin-pBudCE4.1 plasmid ameliorated the hyperglycemia symptoms in diabetic mouse remarkably. It induced an immunological tolerance state in type 1 diabetic mice by inhibiting the proliferation of splenic lymphocytes and recovering Th1/Th2 balance evidenced by MTT and ELISA analysis. Furthermore, it elevated insulin concentration in the serum of type 1 diabetic mice and promoted the regeneration of beta cells supported by the results of HE staining and Tunel assay. In conclusion, RegIII-proinsulin-pBudCE4.1 plasmid possesses powerful anti-diabetic ability, which may be involved in the inducing of immunological tolerance and enhancing beta cells recovery.
6.Effect of Toll-like Receptor 4 on Cerebral Ischemia Reperfusion Injury in Rats
Haihui XING ; Xiaohui DING ; Hui XIE ; Zhonghua WANG ; Juhua XIE ; Fengyang CHEN ; Yinzhou LUO ; Shengnan ZHOU
Journal of China Medical University 2018;47(3):206-211
Objective To explore the effect and mechanism of Toll-like receptor 4 (TLR4) on cerebral ischemia/reperfusion injury. Methods Rats were divided into a sham group, MCAO group, and MCAO+TAK group. Cerebral cortices were removed on day 1, 3, 7, and 14 post surgery. Morphological staining and Western blotting were used to detect pathological changes and TLR4 and P-IKKα/β expression in brain tissues. Results The pathological changes in the MCAO+TAK group were more severe than in the MCAO group on day 1 post surgery. However, the MCAO group exhibited more severe damage at the other time points. TLR4 expression was lowest in the cerebral cortices of the sham group. On day 1 and 14 post surgery, TLR4 expression was lower in the MCAO group than in the MCAO+TAK group, while on day 3 and 7 post surgery, TLR4 expression was higher in the MCAO group than in the MCAO+TAK group. P-IKKα/β expression was highest in the cerebral cortices of the MCAO group at all time points except for day 1. Conclusion TLR4 may alleviate cerebral ischemia reperfusion injury in rats on day 1 post surgery; however, TLR4 may exacerbate ischemia repeifusion injury 3 to 14 days post surgery. The mechanism may be due to the effect of P-IKKα/β expression in the cerebral cortex.
7.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
8.Study on the application of sound thinking combined with Sandwich teaching method in oncology nursing teaching
Juanhua SUN ; Jingjing WANG ; Xiaomin LI ; Shengnan KONG ; Jianing LUO ; Xianna WU ; Wenhui WANG ; Mengxue WANG ; Hongmei ZHANG
Chinese Journal of Medical Education Research 2023;22(4):632-635
Objective:To explore the application of sound thinking combined with Sandwich teaching in oncology nursing practice teaching.Methods:A total of 68 nursing students who were interns in the Department of Oncology, The First Affiliated Hospital of Air Force Medical University from 2020 to 2021 were included in the study, and they were divided into a control group ( n=34) and an observation group ( n=34). The control group took routine teaching for interns, while the observation group took sound thinking combined with Sandwich teaching. The examination results, critical thinking abilities, and the evaluation of nursing teaching effectiveness of the two groups of nursing interns were evaluated. SPSS 22.0 was used for Chi-square test and t-test. Results:The examination scores of nursing students in the observation group were higher than those in the control group ( t=3.44, 2.87, 3.45, P<0.05). Compared with those before training, the scores of critical thinking ability of nursing interns in both groups increased after the training, and the observation group was better than the control group ( t=0.180, 3.64, 0.61, 2.92, 0.31, 2.74, 0.45, 2.65, 0.25, 3.58, 1.16, 2.85, 0.36, 3.20, 0.33, 2.38, P<0.05). The scores of autonomous learning ability, communication and collaboration ability, independent thinking ability, clinical reasoning ability, and problem-analyzing and -solving ability in the observation group were higher than those in the control group ( t=2.82, 3.46, 2.68, 3.29, 2.44, P<0.05). Conclusion:Combining sound thinking with Sandwich teaching in nursing clinical practice teaching in department of oncology can improve the examination scores of nursing students, improve their critical thinking abilities, and enable them to give a high evaluation of nursing teaching effectiveness.
9.Efficacy of vitamin D adjuvant therapy for prevention of spontaneous bacterial peritonitis in patients with decompensated cirrhosis of hepatitis B
Yang ZHANG ; Haijun CHEN ; Yejin XU ; Dehe ZHANG ; Jing ZHOU ; Shengnan LUO
Chinese Journal of Clinical Infectious Diseases 2023;16(3):215-219
Objective:To evaluate the efficacy of vitamin D supplementation for prevention of spontaneous bacterial peritonitis (SBP) in patients with decompensated liver cirrhosis of hepatitis B.Methods:A total of 172 patients with decompensated cirrhosis of hepatitis B admitted in Jinhua Hospital affiliated to Zhejiang University School of Medicine from January to December 2021 were randomly divided into two groups with 86 cases in each group. Patients in both groups received conventional antiviral and symptomatic treatment; while patients in the intervention group received additinal oral vitamin D drops (800 IU/d) for 6 months. After 6 months of treatment, the incidence of SBP and the serum biochemical indexes were compared between two groups. SPSS 21.0 statistical software was used for data analysis.Results:After 6 months of treatment, the incidence of SBP in the intervention group(5.81%, 5/86) was significantly lower than that in control group(30.23%, 26/86)( χ2=19.210, P<0.01). The serum 25-(OH)D level in intervention group was significantly higher than that in the control group ( t=13.425, P=0.018), while the levels of CRP, PCT and IL-6 in intervention group were significantly lower than those in control group ( t=17.312, 10.353 and 12.218, P<0.01 or <0.05). Conclusion:Vitamin D adjuvant therapy can increase serum 25-(OH)D level, decrease serum CRP, PCT and IL-6 levels, and effectively reduce the incidence of SBP in patients with decompensated cirrhosis of hepatitis B.
10.Application of PET-based neuroimaging ATN framework in the diagnosis of Alzheimer′s disease
Min XIONG ; Hongji YOU ; Xiaoming LUO ; Yipei LIU ; Shengnan JIANG
Chinese Journal of Nuclear Medicine and Molecular Imaging 2024;44(12):705-711
Objective:To explore the value of the amyloid-tau-neurodegeneration (ATN) framework in neuroimaging based on PET for diagnosing mild cognitive impairment (MCI) and Alzheimer′s disease (AD), and analyze its relationship with clinical cognition.Methods:From May 2022 to March 2024, a total of 98 cases (23 males and 75 females, age (67.8±8.6) years) with a diagnosis of AD, MCI, or non-AD (control patients, CP) who underwent 18F-FDG, 18F-AV45, and 18F-AV1451 PET/CT imaging in the Second Affiliated Hospital of Guangzhou Medical University were included retrospectively. The clinical data, Mini-Mental State Examination (MMSE), and Montreal Cognitive Assessment (MoCA) scores were recorded. Cases were divided into MCI group, mild AD group, moderate AD group, moderate-severe AD group, and CP group. PET images were visually and semi-quantitatively evaluated. SUV mean and SUV ratio (SUVR) were obtained from independent brain regions of 18F-FDG ( n=8), 18F-AV45 ( n=14) and 18F-AV1451 ( n=14). ROC curve analysis was performed with clinical diagnosis as a criterion. The consistency between visual assessment and the clinical diagnosis was analyzed by Cohen′s Kappa coefficient. Semi-quantitative comparisons between groups were performed using the independent-sample t test, one-way analysis of variance, Mann-Whitney U test, or Kruskal-Wallis rank sum test. Age was used as a covariate to calculate the partial correlation coefficient between SUVR and cognitive scores. Results:The sensitivity and specificity of comprehensive visual assessment in diagnosing AD+ MCI were 87.65%(71/81) and 14/17 respectively, showing a moderate consistency with clinical diagnosis ( Kappa=0.60, P<0.001). Semi-quantitative analysis showed that 18F-FDG uptakes in all independent brain regions of MCI patients were higher than those of AD patients, whereas the uptakes of 18F-AV45 and 18F-AV1451 were lower ( t values: 2.66-3.95, z values: 4.98-15.04, all P<0.05). The difference in 18F-AV45 uptake among the three subgroups of AD was relatively small ( H values: 0.46-4.06, F values: 0.03-0.08, all P>0.05). Except for the medial temporal and occipital lobes, the 18F-AV1451 uptake in the moderate-severe AD group tended to be higher than that in the moderate and mild AD groups, though not statistically significant ( H values: 0.20-5.17, all P>0.05). 18F-FDG PET semi-quantitatively distinguished MCI from CP with a high sensitivity (13/14), 18F-AV45 demonstrated a high sensitivity for diagnosing AD+ MCI (92.59%, 75/81), and 18F-AV1451 had a high specificity for distinguishing AD from MCI (14/14) (AUCs: 0.87, 0.90 and 0.92). The uptakes of 18F-FDG in gray matter of AD and MCI patients were positively correlated with MMSE and MoCA scores ( r values: 0.30-0.43, 0.29-0.45, all P<0.05), while the uptakes of 18F-AV45 and 18F-AV1451 were negatively correlated with MMSE and MoCA scores ( 18F-AV45, r values: from -0.39 to -0.30, from -0.38 to -0.30, all P<0.05; 18F-AV1451, r values: from -0.50 to -0.28, from -0.53 to -0.28, except for medial temporal lobe P>0.05, all others P<0.05). Conclusion:The PET-based neuroimaging ATN framework is helpful for early diagnosis of MCI and AD, as well as for AD staging, and may reflect the disease progression and clinical cognitive status of AD to a certain extent.