Objective To study the effect of calcium gluconate oral solution combined with psychological intervention on preventing the advertise reaction in blood donation by plateletpheresis.Methods From February 2015 to February 2016, 114 cases were collected in Shaoxing downtown blood bank, and were divided into the control group and the experimental group 57 cases in each group.In the blood collection process, the control group were not given any treatment, the experimental group was given calcium gluconate oral liquid combined with psychological intervention.The total incidence adverse reactions and SAS scores in the two groups was compared.Results Before blood donation, Before blood donation, SAS scores in the two groups has no statistically significance.After blood donation, the SAS scores and the total incidence of adverse reactions in the experimental group were significantly lower than those in the control group, the differences in the two groups were statistically significant.(P<0.05).Conclusion Calcium gluconate oral liquid combined with psychological intervention can prevent the adverse reactions in the process of blood donation by plateletpheresis, which is worthy of promotion in the process of plateletpheresis.

Dental Implantation ; Humans ; Surgery, Computer-Assisted

The aim of this study is to investigate the therapeutic effect of RegIII-proinsulin-pBudCE4.1 plasmid on streptozotocin (STZ)-induced type 1 diabetes mellitus and its underlying mechanisms. The model of type 1 diabetes mellitus was established by intraperitoneal injections of STZ (40 mg kg(-1)) to Balb/c mice for five consecutive days. Then, ten type 1 diabetic mice were intramuscularly injected with 100 microg RegIII-proinsulin-pBudCE4.1 plasmid for 4 weeks (one time/week) and the blood glucose levels were monitored every week; whereas another ten diabetic mice served as negative control group were injected with pBudCE4.1 vector at the same dose. Normal control and model control mice were treated with normal saline at identical volume under the same way. Western blotting, MTT assay, ELISA, HE staining and Tunel assay were applied to explore the underlying mechanisms. Results showed that RegIII-proinsulin-pBudCE4.1 plasmid ameliorated the hyperglycemia symptoms in diabetic mouse remarkably. It induced an immunological tolerance state in type 1 diabetic mice by inhibiting the proliferation of splenic lymphocytes and recovering Th1/Th2 balance evidenced by MTT and ELISA analysis. Furthermore, it elevated insulin concentration in the serum of type 1 diabetic mice and promoted the regeneration of beta cells supported by the results of HE staining and Tunel assay. In conclusion, RegIII-proinsulin-pBudCE4.1 plasmid possesses powerful anti-diabetic ability, which may be involved in the inducing of immunological tolerance and enhancing beta cells recovery.

Aim To explore the effect of meloxicam on the CUMS-induced depressive-like behaviors in rats and its preliminary mechanism. Methods The rats were exposed to CUMS procedure for 6 weeks to estab-lish the model of depression. Meloxicam(1,3 mg· kg-1 ) and sertraline(5 mg·kg-1 ) were administered to rats from 22d of the stress procedure(once a day,for 21 days,p. o. ) . Depressive-like behaviors were evalu-ated by the open-field test and force swimming test. The levels of PGE2 and TNF-αin cortex were measured by ELISA. Moreover, the concentrations of NE, DA, DOPAC and 5-HIAA were also measured by HPLC, and the protein expression of 5-HT1 AR in cortex was analyzed by the immunohistochemistry. Results Com-pared with the rats of normal control group,the vertical and horizontal movement scores of rats in the open-field test were decreased and the immobility time in the forced swimming test was increased in model group. The levels of PGE2 and TNF-α were both increased signifi-cantly,whereas the concentrations of NE, DA, DOPAC and 5-HIAA were decreased and the expression of 5-HT1AR was reduced in cortex. Compared with the rats of model group, meloxicam significantly improved the depressive behaviors of rats in experimental groups and reversed the content of PGE2 ,TNF-α,NE,DA,DOPAC and 5-HIAA, as well as the expression of 5-HT1AR. Conclusion Meloxicam has a significant protective effect on CUMS-induced depressive-like behaviors, and the protective mechanism might be related to atten-uating inflammation response and reconstructing the balance of the monoamine neurotransmitter system in rat cortex.

Objective To explore the effect and mechanism of Toll-like receptor 4 (TLR4) on cerebral ischemia/reperfusion injury. Methods Rats were divided into a sham group, MCAO group, and MCAO+TAK group. Cerebral cortices were removed on day 1, 3, 7, and 14 post surgery. Morphological staining and Western blotting were used to detect pathological changes and TLR4 and P-IKKα/β expression in brain tissues. Results The pathological changes in the MCAO+TAK group were more severe than in the MCAO group on day 1 post surgery. However, the MCAO group exhibited more severe damage at the other time points. TLR4 expression was lowest in the cerebral cortices of the sham group. On day 1 and 14 post surgery, TLR4 expression was lower in the MCAO group than in the MCAO+TAK group, while on day 3 and 7 post surgery, TLR4 expression was higher in the MCAO group than in the MCAO+TAK group. P-IKKα/β expression was highest in the cerebral cortices of the MCAO group at all time points except for day 1. Conclusion TLR4 may alleviate cerebral ischemia reperfusion injury in rats on day 1 post surgery; however, TLR4 may exacerbate ischemia repeifusion injury 3 to 14 days post surgery. The mechanism may be due to the effect of P-IKKα/β expression in the cerebral cortex.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Objective:To evaluate the efficacy of vitamin D supplementation for prevention of spontaneous bacterial peritonitis (SBP) in patients with decompensated liver cirrhosis of hepatitis B.Methods:A total of 172 patients with decompensated cirrhosis of hepatitis B admitted in Jinhua Hospital affiliated to Zhejiang University School of Medicine from January to December 2021 were randomly divided into two groups with 86 cases in each group. Patients in both groups received conventional antiviral and symptomatic treatment; while patients in the intervention group received additinal oral vitamin D drops (800 IU/d) for 6 months. After 6 months of treatment, the incidence of SBP and the serum biochemical indexes were compared between two groups. SPSS 21.0 statistical software was used for data analysis.Results:After 6 months of treatment, the incidence of SBP in the intervention group(5.81%, 5/86) was significantly lower than that in control group(30.23%, 26/86)( χ2=19.210, P<0.01). The serum 25-(OH)D level in intervention group was significantly higher than that in the control group ( t=13.425, P=0.018), while the levels of CRP, PCT and IL-6 in intervention group were significantly lower than those in control group ( t=17.312, 10.353 and 12.218, P<0.01 or <0.05). Conclusion:Vitamin D adjuvant therapy can increase serum 25-(OH)D level, decrease serum CRP, PCT and IL-6 levels, and effectively reduce the incidence of SBP in patients with decompensated cirrhosis of hepatitis B.

Objective:To explore the application of sound thinking combined with Sandwich teaching in oncology nursing practice teaching.Methods:A total of 68 nursing students who were interns in the Department of Oncology, The First Affiliated Hospital of Air Force Medical University from 2020 to 2021 were included in the study, and they were divided into a control group ( n=34) and an observation group ( n=34). The control group took routine teaching for interns, while the observation group took sound thinking combined with Sandwich teaching. The examination results, critical thinking abilities, and the evaluation of nursing teaching effectiveness of the two groups of nursing interns were evaluated. SPSS 22.0 was used for Chi-square test and t-test. Results:The examination scores of nursing students in the observation group were higher than those in the control group ( t=3.44, 2.87, 3.45, P<0.05). Compared with those before training, the scores of critical thinking ability of nursing interns in both groups increased after the training, and the observation group was better than the control group ( t=0.180, 3.64, 0.61, 2.92, 0.31, 2.74, 0.45, 2.65, 0.25, 3.58, 1.16, 2.85, 0.36, 3.20, 0.33, 2.38, P<0.05). The scores of autonomous learning ability, communication and collaboration ability, independent thinking ability, clinical reasoning ability, and problem-analyzing and -solving ability in the observation group were higher than those in the control group ( t=2.82, 3.46, 2.68, 3.29, 2.44, P<0.05). Conclusion:Combining sound thinking with Sandwich teaching in nursing clinical practice teaching in department of oncology can improve the examination scores of nursing students, improve their critical thinking abilities, and enable them to give a high evaluation of nursing teaching effectiveness.

Objective To analyze the clinical and laboratory characteristics,treatment,and outcomes of Ka-wasaki disease (KD)patients associated with macrophage activation syndrome (MAS)(KD - MAS)and to compare three diagnostic standards. Methods Twelve cases of KD - MAS were reviewed retrospectively,who had been treated and therapied at the Children′s Hospital of Chongqing Medical University from September 2007 to September 2017. The clinical data were analyzed. And,the efficacy of different MAS diagnostic criteria for KD - MAS was evaluated. Results The subjects included 8 males and 4 females,with a median age of 25 months. The capital trigger of MAS was infection(8 cases,66. 7％). Unabating high fever had been the initial manifestation for 12 patients(100％),other com-mon clinical features including hepatomegaly(11 cases,91. 6％),splenomegaly(8 cases,66. 7％)and lymphadenectasis (7 cases,58. 3％). Besides,8 patients (66. 7％)had different degrees of central nervous system symptoms. Laboratory examination showed a decrease in hemoglobin (11 cases,91. 6％),in thrombocytopenia (8 cases,66. 7％),and white blood cells (4 cases,33. 3％);while there was an increase were found in serum transaminase (11 cases,91. 6％), triglyceride(72. 7％,8 / 11 cases)and serum ferritin (100％,9 / 9 cases). Eleven patients (91. 6％)had decreased erythrocyte sedimentation rates (ESR). Bone marrow cytology was performed in 10 cases,and 8 cases of them showed hemophagocytic phenomenon. All the patients were diagnosed by SoJIA - MAS(2005)criteria. All patients were treated with high - dose intravenous immunoglobulin (IVIG)treatment,among whom 3 cases were combined with methylpred-nisolone treatment,and 2 cases received with more than 2 kinds of immunosuppressive drugs (Dexamethasone and Ciclosporin or Etoposide). Among the 12 patients,2 patients lost to follow - up,4 cases(33. 3％)died due to hepatic encephalopathy,including 2 cases who withdrawn treatment the remaining 6 cases (50. 0％)improved. Conclusions Prolonged high fever is the first manifestation of MAS in KD. Hemogram and ESR will decrease,elevated serum transaminase and ferritin may increase,which indicates MAS occurrence. If a high dose of IVIG therapy does not work,the combination of glucocorticoid and immunosuppressive for therapy may improve the remission rate. Severe cen-tral nervous system involvement may indicate a terrible prognosis. SoJIA - MAS (2005)can diagnose earliler by using preliminary diagnostic guidelines for macrophage activation system complicating systemic juvenile idiopathic arthritis.