To investigate the changes in refractive error following strabismus surgery, we stratified a total of 32 exotropic patients; 11 patients with horizontal recess/resect procedure in one eye; 11 patients with lateral rectus recession in one eye; and 10 patients with medial rectus resection in one eye. The cycloplegic refraction and corneal topography were examined prospectively in each group. We found a significant decrease in the refractive power at 180degrees meridian resulting in with the rule astigmatism in lateral rectus muscle recess group (p<0.05) and a significant decrease in the refractive power at 90degrees meridian resulting in against the rule astigmatism in medial rectus resection group in the first week after surgery (p<0.05). However, there was no statistically significant change due to mixture of the two procedures in recess/resect group. The changes in refractive power in four months after surgery gradually recovered to preoperative state in each group except 90degrees meridian in medial rectus resection group. These results indicate that the changes in refractive error in one week after strabismus surgery involved steepening of 180degrees meridian in medial rectus resection group, and flattening of 180degrees meridian in lateral rectus muscle recession group. However, there was no statistically significant change due to mixture of the two procedures in recess/resect group.
Astigmatism ; Corneal Topography ; Humans ; Prospective Studies ; Refractive Errors* ; Strabismus*

The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed. In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGACGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions(2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.
Blotting, Southern ; DNA ; Electrophoresis, Agar Gel ; Herpes Simplex* ; Humans ; Keratitis ; Keratitis, Herpetic ; Polymerase Chain Reaction ; Simplexvirus*

BACKGROUND: Interactions of neuromuscular blocking agents are antagonistic in a combination of depolarizing and nondepolarizing agents, additive in a combination of relative two compounds or synergistic in a combination of different two nondepolarizing agents. However, the interactions of neuromuscular blocking agents with a different site of action from each other have not been studied clearly. This study was designed to examine the interaction between hexamethonium and lidocaine, alpha-bungarotoxin or decamethonium with markedly different pre and postsynaptic sites of action. METHODS: Square wave, 0.1 Hz supramaximal stimuli or 2 Hz, 0.2 ms train of four (TOF) stimuli, was applied to the rat phrenic nerve-hemidiaphragm preparation, and the twitch height response was recorded mechanomyographically. The cumulative concentration effect and TOF ratio at each point of twitch depression after hexamethonium, lidocaine, alpha-bungarotoxin or decamethonium given were measured. The EC50 and EC95 of hexamethonium, lidocaine, alpha-bungarotoxin and decamethonium were calculated using an inhibitory sigmoid Emax model. In the experiment of each combination of two drugs, three points of the isobole for hexamethonium-lidocaine, hexamethonium-alpha-bungarotoxin and hexamethonium-decamethonium were established using ratios of 1 : 3, 1 : 1 and 3 : 1 of their EC50. Points on the line of theoretical additivity and 95% confidence intervals were calculated according to Tallarida et al. TOF ratios were observed at 75, 50 and 25% of the control twitch height value during each combination ratio of their EC50. RESULTS: Significant deviations of points on the isobole from the line of additivity to the left were found at all EC50 ratios of hexamethonium-lidocaine (P < 0.05 respectively), that to the right was found at all EC50 ratios of a hexamethonium-alpha-bungarotoxin and hexamethonium-decamethonium (P < 0.05 respectively). The magnitude of TOF fade depended upon the mixed ratios for their EC50. CONCLUSIONS: The interaction was found to be synergistic in the combination of hexamethonium- lidocaine, and antagonistic in the combination of hexamethonium-alpha-bungarotoxin and hexamethonium- decamethonium.
Animals ; Bungarotoxins* ; Colon, Sigmoid ; Depression ; Hexamethonium* ; Lidocaine* ; Neuromuscular Blocking Agents ; Rats

OBJECTIVE: The authors present eight cases of immediate post-operative epidural hematomas(EDHs) adjacent to the craniotomy site, describe clinical details of them, and discuss their pathogenesis. METHODS: Medical records of eight cases were retrospectively reviewed and their clinical data, operation records, and radiological findings analyzed. Any risk factors of the EDHs were searched. RESULTS: In 5 of 8 cases, adjacent EDHs developed after craniotomies for the surgical removal of brain tumors. Three cases of adjacent EDHs developed after a pterional approach and neck clipping of a ruptured anterior communicating artery aneurysm, a ventriculoperitoneal shunt, and a craniotomy for a post-traumatic EDH, respectively. In all eight cases, brain computed tomography (CT) scans checked immediately or a few hours after the surgery, revealed large EDHs adjacent to the previous craniotomy site, but there was no EDH beneath the previous craniotomy flap. After emergent surgical removal of the EDHs, 7 cases demonstrated good clinical outcomes, with one case yielding a poor result. CONCLUSION: Rapid drainage of a large volume of cerebrospinal fluid or intra-operative severe brain collapse may separate the dura from the calvarium and cause postoperative EDH adjacent to the previous craniotomy site. A high-pressure suction drain left in the epidural space may contribute to the pathogenesis. After the craniotomy for brain tumors or intracranial aneurysms, when remarkable brain collapse occurs, an immediate postoperative brain CT is mandatory to detect and adequately manage such unexpected events as adjacent EDHs.
Brain ; Brain Neoplasms ; Cerebrospinal Fluid ; Craniotomy* ; Drainage ; Epidural Space ; Hematoma* ; Intracranial Aneurysm ; Medical Records ; Neck ; Retrospective Studies ; Risk Factors ; Skull ; Suction ; Ventriculoperitoneal Shunt

BACKGROUND: Propofol, 2,6-diisopropyl phenol, is a short-acting, potent intravenous anesthetics agent. In both general anesthetic care and the anesthetic care of patients undergoing cardiovascular surgery, the unique characteristics of propofol might make it a logical part of the anesthetic plan for patients such as pulmonary hypertension. But there are limited experimental and clinical data on the effects of propofol on pulmonary vascular resistance, and they are somewhat contradictory. the purpose of this study was to investigated.the effect and mechanism of vasodilation induced by propofol using isolated rat pulmonary artery rings. METHODS: Cumulative dose-response curves for propofol(10(-6)~10(-3)M) were obtained from tension measurements of rings that contracted with phenylephrine(10(-6)M) and KCI(40 mM) in the presence and absence of endothelium, and in the pretreatment of L-NAME(3x10(-4)M) and substance P(3x10(-4)M). Thereafter the effect of propofol(10(-4)M) on vascular smooth muscle contration in response to Ca++ mobilization in vscular rings were investigated. RESULTS: Propofol(10(-6)~10(-3)M) produced dose-dependent relaxation and had no signficant effect from endothelium. Pretreatment of L-NAME and substance P failed to have influence on cumulative dose-respose curves. Therefore vasodilator effect of propofol was not endothelium-dependent. And 10(-4)M propofol attenuated a contraction in response to CaCl2 in vascular rings depolarized by KCI, and vasoconstraction in response to calcium entry in the presence of phenylephine was attenuated by 10(-4)M propofol. Ryanodine preteament had not influence on contractile response. CONCLUSIONS: These results suggest that vasodilation produced by propofol is not endothelium-dependent but is probably due to nonspecific intracellular Ca++ influx blockade through voltage-operated calcium channels and receptor-operated channels.
Anesthetics ; Anesthetics, Intravenous ; Animals ; Calcium ; Calcium Channels ; Endothelium ; Humans ; Hypertension, Pulmonary ; Logic ; Muscle, Smooth, Vascular ; NG-Nitroarginine Methyl Ester ; Phenol ; Propofol* ; Pulmonary Artery* ; Rats* ; Relaxation ; Ryanodine ; Substance P ; Vascular Resistance ; Vasodilation

A 19-month-old boy suffered from stridor and dysphagia. He was taking asthma medication for a few months, but symptoms did not improve. After admission, a chest CT showed a posterior mediastinal mass, which compressed the trachea and esophagus. The removed mass via open thoracotomy was a bronchogenic cyst on histopathology. Postoperatively, stridor and dysphagia disappeared. In case of persistent and refractory stridor or dysphagia in children, congenital lesions including bronchogenic cyst need to be ruled out.
Asthma ; Bronchogenic Cyst ; Child ; Deglutition Disorders ; Esophagus ; Humans ; Infant ; Mediastinum ; Respiratory Sounds ; Thoracotomy ; Thorax ; Trachea

Although fibromas are the most common renal medullary tumor identified at autopsy. their small sized and benign course make clinical detection extremely difficult. Only 9 clinical cases of renal medullary fibromas have been reported. Many fibromas of the renal medulla, previously considered as bamahomas. seemed to be composed of tumerous transformation of renomedullary interstitial calls Herein we report on a patient with huge renal medullary fibroma treated by right radical nephrectomy.
Autopsy ; Brain Stem Neoplasms ; Fibroma ; Humans ; Nephrectomy

The Nuss procedure has good cosmetic effects, but it could be cause of bleeding and organ injury during dissection of the anterior mediastinum. We have made an effort to overcome the defects of the traditional method through the anterior mediastinum, thus we developed a transilluminated introducer that made it safer and simpler to operate within a 1 cm incision only. A total of 67 patients underwent the Nuss procedure using the transilluminated introducer. Thirty-six patients underwent the procedure with the transilluminated introducer only (age<14 years). Thirty-one patients had an additional thoracoscopy (age> or =14 years). There were no major complications, such as massive bleeding or organ injury in the thoracic cavity during or after the Nuss procedure. Our findings demonstrated that the anterior mediastium could be dissected simply and safely by the use of a transilluminated introducer during the Nuss procedure without fatal major complications, such as bleeding and organ injury.
Cosmetics ; Funnel Chest ; Hemorrhage ; Humans ; Mediastinum ; Thoracic Cavity ; Thoracic Wall ; Thoracoscopy

Objective: To investigate the diagnostic performance of quantitative ultrasound (US) parameters for the assessment of hepatic steatosis in patients with nonalcoholic fatty liver disease (NAFLD) using magnetic resonance imaging proton density fat fraction (MRI-PDFF) as the reference standard. Materials and Methods: In this single-center prospective study, 120 patients with clinically suspected NAFLD were enrolled between March 2019 and January 2020. The participants underwent US examination for radiofrequency (RF) data acquisition and chemical shift-encoded liver MRI for PDFF measurement. Using the RF data analysis, the attenuation coefficient (AC) based on tissue attenuation imaging (TAI) (AC-TAI) and scatter-distribution coefficient (SC) based on tissue scatterdistribution imaging (TSI) (SC-TSI) were measured. The correlations between the quantitative US parameters (AC and SC) and MRI-PDFF were evaluated using Pearson correlation coefficients. The diagnostic performance of AC-TAI and SC-TSI for detecting hepatic fat contents of ≥ 5% (MRI-PDFF ≥ 5%) and ≥ 10% (MRI-PDFF ≥ 10%) were assessed using receiver operating characteristic (ROC) analysis. The significant clinical or imaging factors associated with AC and SC were analyzed using linear regression analysis. Results: The participants were classified based on MRI-PDFF: < 5% (n = 38), 5–10% (n = 23), and ≥ 10% (n = 59). AC-TAI and SC-TSI were significantly correlated with MRI-PDFF (r = 0.659 and 0.727, p < 0.001 for both). For detecting hepatic fat contents of ≥ 5% and ≥ 10%, the areas under the ROC curves of AC-TAI were 0.861 (95% confidence interval [CI]: 0.786– 0.918) and 0.835 (95% CI: 0.757–0.897), and those of SC-TSI were 0.964 (95% CI: 0.913–0.989) and 0.935 (95% CI: 0.875–0.972), respectively. Multivariable linear regression analysis showed that MRI-PDFF was an independent determinant of AC-TAI and SC-TSI. Conclusion AC-TAI and SC-TSI derived from quantitative US RF data analysis yielded a good correlation with MRI-PDFF and provided good performance for detecting hepatic steatosis and assessing its severity in NAFLD.

Purpose: Mechanical and functional ankle instability or combinations of both can contribute to chronic ankle instability (CAI). Therefore, the purpose of this study was to compare the difference in (1) static and (2) dynamic balance function between patients with CAI and the controls; (3) to investigate association between balance function and CAI; and (4) to examine whether balance assessments are valuable for diagnosing CAI. Methods: This study was conducted on 40 patients with CAI and 40 ankle healthy individuals. All participants evaluated the Cumberland Ankle Instability Tool questionnaire. Additionally, joint laxity and center of pressure (COP) during static postural control, anterior landing, and lateral landing were measured using an electronic pedobarography. Results: CAI patients showed a larger COP area than controls when performing static postural control (p=0.023) and lateral landing (p=0.002). As a result of the receiver operation characteristic curve analysis, COP distance, area, and speed during static postural control and COP area during lateral landing showed low accuracy, indicating that they are valuable evaluations for the diagnosis of CAI. Conclusion Patients with CAI had poor static and dynamic postural control ability. The static posture control and the lateral landing test had diagnostic significance to evaluate the objective function of CAI.