Humans ; Hydrogen Sulfide ; poisoning ; Male ; Methylene Blue ; therapeutic use ; Poisoning ; therapy ; Young Adult

Child ; Humans ; Karyotyping ; Male ; Osteochondrodysplasias ; classification ; diagnosis ; genetics

Bone Neoplasms ; diagnosis ; pathology ; Breast Neoplasms ; diagnosis ; pathology ; Delayed Diagnosis ; Diagnostic Errors ; Female ; Frozen Sections ; Humans ; Intraoperative Period ; Retrospective Studies ; Thyroid Neoplasms ; diagnosis ; pathology

Objective To investigate the characteristics of the preoperative and postoperative urodynamical parameters of women with uterine cervical carcinoma after radical hysterectomies.Methods Forty-six women had uterine cervical carcinoma at stage Ⅰ b or Ⅱ a.Complete pre-and postoperative urodynamie follow-ups were conducted for each patient.Results Twenty-six women(57%)who had preoperatively normal urinary tract function needed to void by abdominal straining after radical surgery.After the radical hysterectomy,the postvoid residual volume[(205?201)vs(5?3)ml,P

Objective To explore the influence of lamotrigine(LTG)and valproate(VAP)on cognitive function in children with epilepsy.Methods Seventy-six epileptic children firstly diagnosed were chosen,36 cases received LTG monotherapy and 40 cases undwent the treatment of VPA.The intelligence quotient(IQ)value was measured before and after 6 months treatment respectively,and 20 healthy children were selected as healthy control.Results 1.The epileptic children had poor verbal intelligence quotient(VIQ),performance intelligence quotient(PIQ)and full intelligence quotient(FIQ)compared to the control subjects(Pa0.05).But among the subtestings,the know-ledge,wood-graph,coded score of the VPA groups had significant difference(Pa

Objective To explore the application effects of nursing teacher standard patient (TSP) to objective structured clinical examination (OSCE).Methods Students were given a mark from aspects of inquisition score table,nursing evaluation,nursing diagnosis,nursing plan and health education.Then examination results were analyzed.Results The data were normal distribution.The evaluation results were objective and effective.Conclusions Using TSP to evaluate nursing students is helpful for them to cultivate their clinical thinking model of taking patients as the centre.

Objective To investigate whether porcine endothelial cells transfected with SP1 de-coy ODNs could resist complement-mediated cytotoxicity during the model of SV-40-PED with human serum in vitro. Methods Immortalized porcine aortic endothelial cells of the line PED were divided in-to three groups. The transfected group was SV-40-PED with SP1 decoy ODNs. The mismatched group was SV-40-PED with scrambled SP1 decoy ODNs. The negative group was cells with oligo-fectamine only. The expression of α1,3-GT mRNA and αGal was detected after 26 h by using fluores-cence microscope, Western blot, RT-PCR and lactate dehydrogenase (LDH) activity assay. Results Fluorescence microscopy observed the decreased fluorescence of αGal after SP1 decoy ODNs transfec-tion. Dotted fluorescent decrease could be observed on some membrane while the mismatched group and negative group with bright green fluorescence. Western blot showed that the average absorbance of the PED cells transfected with decoy ODNs was decreased to 52.6% of the negative group (P<0.05). The expression of α1,3-GT mRNA in the PED cells transfected with decoy ODNs was 0.42±0.20 (isoform 1) and 0.27±0.12 (isoform 2) respectively, significantly lower than in the negative group (isoform 1, 0.72±0.17; isoform 2, 0.50±0.19; both P<0.05). The expression of α1, 3-G Tin the mismatch group was not different from that in the negative group (P>0.05). 20% normal hu-man serum (NHS) and 40 % NHS had cytotoxic effect on both mismatch and negative groups, but de-coy ODNs could confer SV-40-PED protection from the cytolysis effect (P<0.05), which made a re-markable reduction of complement-mediated cytotoxicity towards SV-40--PED. Conclusions SP1 decoy ODNs could confer porcine endothelial cells protection from complement-mediated cytotoxicity effect in vitro.

Adenocarcinoma ; metabolism ; secondary ; Adult ; Aged ; CDX2 Transcription Factor ; Carcinoma, Signet Ring Cell ; metabolism ; pathology ; Colonic Neoplasms ; metabolism ; pathology ; Cystadenocarcinoma, Mucinous ; metabolism ; pathology ; Cystadenocarcinoma, Serous ; metabolism ; pathology ; Diagnosis, Differential ; Female ; Homeodomain Proteins ; metabolism ; Humans ; Keratin-20 ; metabolism ; Keratin-7 ; metabolism ; Middle Aged ; Ovarian Neoplasms ; metabolism ; pathology ; secondary ; Trans-Activators ; metabolism ; Young Adult

Objective:To investigate the role of transcription factor SP1 decoy oligodeoxynucleotides(ODN) on expression of ? Gal in SV-40-PED cells.Methods:Immortalized porcine aortic endothelial cells of the PED line were cultured and transfected with ?1,3galactosyltransferase(?1,3GT) specific decoy ODN.Cells transfected with mismatch ODN was used as negative controls.Twenty-six hours later the cells were collected.The expression of ? Gal was determined with fluorescence microscope and Western blot.The expression of ?1,3GT mRNA was examined by RT-PCR.Results:Fluorescence microscopy observed the decreased fluorescence of ? Gal after decoy ODN transfection.Western blot showed that the average absorbance of the PED cells transfected with decoy ODNs was(48.2?0.9).It is 52.6% of the mock group(P0.05).Conclusion:?1,3GT gene reduce actually occurs following transfection of decoy ODN.Porcine endothelial cells can be the targets of decoy ODN.

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics