OBJECTIVETo investigate the mechanism of cytokeratin 13 (CK13) gene expression control and the effects of different motifs of CK13 gene 5' flanking region on its transcriptional activity.

METHODSThe molecular clone technique and reporter gene analysis were used to assay the effects of different motifs of 513 bp of CK13 gene 5' flanking region on its transcriptional activity. The pCAT enhancer vectors with different motifs of CK13 gene 5' flanking region were constructed and transferred to HeLa cells with the help of lipofectin. The instant CAT expression of different clones was detected and the effects of different motifs of the CK13 gene 5' flanking region on its transcriptional activity were evaluated.

RESULTS119 bp from -nt.325 to -nt.207 upstream of the first ATG of CK13 gene 5' flanking region included a silent element. 113 bp region from -nt.206 to -nt.94 included an enhanced element.

CONCLUSION513 bp of CK13 gene 5' flanking region includes a silent element and an enhanced element. Further locating these cis elements and detecting the related trans reaction factors may unveil some important clues to the details of the mechanisms for the CK13 gene expression and tissue-specific expression.

5' Flanking Region ; genetics ; Base Sequence ; Chloramphenicol O-Acetyltransferase ; genetics ; metabolism ; Enhancer Elements, Genetic ; genetics ; HeLa Cells ; Humans ; Keratins ; genetics ; Molecular Sequence Data ; Recombinant Fusion Proteins ; genetics ; metabolism ; Regulatory Sequences, Nucleic Acid ; genetics ; Transcription, Genetic ; genetics ; Transfection ; methods

Fruit ripening is associated with a number of physiological and biochemical changes. They include degradation of chlorophyll, synthesis of flavor compounds, carotenoid biosynthesis, conversion of starch to sugars, cell wall solublisation and fruit softening. These changes are brought about by the expression of specific genes. People are interested in the molecular mechanism involved in the regulation of gene transcription during fruit ripening. Many fruit-specific promoters such as PG, E4, E8, and 2A11 have been characterized and shown to direct ripening-specific expression of reporter genes. AGPase plays the key role in catalyzing the biosynthesis of starch in plants. It is a heterotetrameric enzyme with two small subunits and two large subunits, which are encoded by different genes. In higher plants, small subunits are highly conserved among plant species and expressed in all tissues. And the large subunits are present at multiple isoforms and expressed in a tissue-specific pattern. In fruits, the expression pattern of the large subunits varies with plant species. That made it important to study the transcriptional regulation of the large subunits of AGPase in different plant species. Northern-blot analysis indicates in watermelon, an isoform of the large subunits Wml1 expressed specifically in fruits, not in leaves. The 5' flanking region of Wml1, which covers 1573bp, has been isolated through the method of uneven PCR. And transient expression assay has shown that the 1573bp (named WSP) can direct fruit-specific expression of GUS gene. Our goal in this study was to scan the promoter region for main regulatory regions involved in fruit-specific expression. A chimaeric gene was constructed containing the WSP promoter, the beta-glucuronidase (GUS) structural sequence as a reporter gene and the nopaline synthase polyadenylation site (NOS-ter). The plasmid pSPA was digested with Hind III + Hinc II and promoter fragment of 1573bp (from 180bp to 1752bp) was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-16. The same insert was then cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by HindIII + Bgl II to produce pISPA-16. Three 5'-end deletions of the promoter were obtained and fused to GUS gene in plant transient expression vector pBI426: the 1201bp fragment (from 551bp to 1752bp) was generated by digestion of pBSPA-16 with BamH I + SnaB I, the 898bp fragment (from 854bp to 1752bp) by BamH I + EcoRV. Both fragments were ligated with pBluescript SK(-) digested by BamH I + Sma I, to produce pBSPA-12 and pBS-PA-9. The inserts were cut out with HindmIII + BamH I and ligated with pBI426 digested by Hind III + Bgl II, to produce pISPA-12 and pISPA-9. The 795bp fragment (from 957bp to 1752bp) was generated by digestion of pSPA with Hinc II + EcoR I, promoter fragment was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-8. The same insert were cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by Hind III + Bgl II. The 1573bp fragment and three 5'-end deletions were delivered into watermelon leaf, stem, flower and fruit of different development stages (5, 10, 20 days after pollination) via particle bombardment using a biolistic PDS-1000/He particle gun. Bombardment parameters were as follows: a helium pressure of 1200 psi, vacuum of 91432.23Pa, 7 cm between the stopping screen and the plate. Histochemical assay were done on all the tissues bombarded after incubation for 2 days. The 1573bp fragment had the strongest promoter activity, and can induce GUS expression in fruits of 5 and 20 days after anthesis and flowers, but not in fruits of 10 days after anthesis, leaves and stems. Fragments of 1201bp and 898bp can induce GUS expression only in fruits of 20 days after anthesis, and with lower expression levels than 1573bp. Fragment of 795bp was not able to direct GUS expression in any of the tissues bombarded (data not shown). It can be concluded that of the 1573bp, 1201 bp, 898bp Wml1 5'flanking regions include the necessary information directing fruit-specific expression. Deletion from 180bp to 551bp doesn't affect the fruit-specificity of the promoter, but lowered the expression level. There may be some cis-acting elements located in this region, which can enhance external gene expression in later stages of fruit development. Deletion from 854bp and 958bp led to loss of GUS expression. This region includes the necessary information needed for gene expression as well as the regulatory elements for fruit-specific transcription.
Citrullus ; genetics ; Fruit ; genetics ; Gene Expression Regulation, Plant ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics ; physiology

To understand the mechanism of transcriptional regulation, it is essential to detect promoters and regulatory elements. Various kinds of methods have been introduced to improve the prediction accuracy of regulatory elements. Since there are few experimentally validated regulatory elements, previous studies have used criteria based solely on the level of scores over background sequences. However, selecting the detection criteria for different prediction methods is not feasible. Here, we studied the calibration of thresholds to improve regulatory element prediction. We predicted a regulatory element using MATCH, which is a powerful tool for transcription factor binding site (TFBS) detection. To increase the prediction accuracy, we used a regulatory potential (RP) score measuring the similarity of patterns in alignments to those in known regulatory regions. Next, we calibrated the thresholds to find relevant scores, increasing the true positives while decreasing possible false positives. By applying various thresholds, we compared predicted regulatory elements with validated regulatory elements from the Open Regulatory Annotation (ORegAnno) database. The predicted regulators by the selected threshold were validated through enrichment analysis of muscle-specific gene sets from the Tissue-Specific Transcripts and Genes (T-STAG) database. We found 14 known muscle-specific regulators with a less than a 5% false discovery rate (FDR) in a single TFBS analysis, as well as known transcription factor combinations in our combinatorial TFBS analysis.
Binding Sites* ; Calibration ; Regulatory Sequences, Nucleic Acid ; Transcription Factors*

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics

OBJECTIVES: This study was carried out to explore the relationship between the impulsiveness and aggressiveness in adolescent prisoners and a polymorphism of the promoter region of the 5-HTT gene (5HTTLPR). METHODS: 198 adolescent prisoner volunleers and 68 male medical students as a normal control group were included in this study. The characteristics of adolescent prisoners and control subjects were assessed by using Barratt Impulsiveness Scale and Achenbach's Child Behavior Checklist (CBCL). Genotypes of 5-HTTLPR were analysed with the primers flanking the regulatory region from genomic DNA. RESULTS: Adolescent prisoners were significantly more aggressive (t=4.780, df=248, p<0.001), impulsive (t=5.220, df=248, p<0.001), and delinquent (t=12.299, df=173.554, p<0.001) than control group. There were no statistically significant differences in genotype frequencies of 5-HTT between adolescent prisoners and control group (chi2=2.378, df=6, p=0.882). There were no statistically significant differences in allelic frequencies of 5-HTT between adolescent prisoners and control group (chi2=2.027, df=4, p=0.731). CONCLUSION: In view of the negative results in the association of the promoter region polymorphism of serotonin transporter and the characteristics of adolescent prisoner, the promoter region polymorphism dose not appear to be a candidate gene for the characteristics of adolescent prisoner group. Further systematic researches including varying variables of phenotype would be required.
Adolescent* ; Checklist ; Child ; Child Behavior ; DNA ; Genotype ; Humans ; Male ; Phenotype ; Prisoners* ; Prisons* ; Promoter Regions, Genetic* ; Regulatory Sequences, Nucleic Acid ; Serotonin Plasma Membrane Transport Proteins* ; Serotonin* ; Students, Medical

OBJECTIVES: Serotonin transporter (5-HTT) is a key synaptic regulator of serotonergic neurotransmission and a major site of action of serotonin selective reuptake inhibitors (SSRIs) such as fluoxetine or paroxetine. Two PCR-fomatted polymorphisms at this locus have been described, the first of which is a repeat sequence polymorphism located in the promoter region (5-HTT gene-linked polymorphic region, 5-HTTLPR), and the second is a variable number tandem repeat located in intron2 (STin2). 5-HTTLPR insertion/deletion polymorphism with long (l) and short (s) forms affects the transcriptional efficiency of 5-HTT transporter expression. We examined the pharmacodynamic characteristic of 5-HTT gene polymorphism in the patients with major depression, which was expressed in the peripheral platelet. METHODS: 5-HTT gene polymophisms and pharmacodynamic characteristics of 5-HTT in the platelet was measured in 41 patients with major depression defined by DSM IV criteria and 35 healthy normal volunteers. 5-HTT gene polymophisms were analyzed with the primers flanking the regulatory region and the second intron from genomic DNA. Pharmacodynamic characteristics of 5-HTT in the platelet was measured with [3H]-serotonin uptake study. The uptake of [3H]-serotonin was quantified with Vmax and Km value. RESULTS: We found that the Vmax value of 5-HTT in peripheral platelet was higher in the patients with s/s genotype (2.17 pmol/10(4) platelets/min, 1.53-3.90 pmol/10(4) platelets/min) than with s/l (1.73 pmol/10(4) platelets/min, 0.83-3.40 pmol/10(4) platelets/min) or l/l (1.0(4) pmol/10(4) platelets/min, 0.88-1.31 pmol/10(4) platelets/min) genotype of 5-HTTLPR. Normal subjects with s/s genotype also had significantly higher Vmax value than those with s/l or l/l genotype. However, STin2 genotype showed no significant association with Vmax or Km in both groups. CONCLUSIONS: These results suggest that allelic variation of 5-HTT gene affects the phenotypic expression of 5-HTT in human platelet, and may be linked with phenotypic heterogeneity in the antidepressant responsiveness in depressed patients. This is another different finding based on ethnic variation with respect to pharmacodynamic characteristics of 5-HTT gene polymorphism.
Blood Platelets* ; Depression ; DNA ; Fluoxetine ; Genotype ; Healthy Volunteers ; Humans ; Introns ; Paroxetine ; Population Characteristics ; Promoter Regions, Genetic ; Regulatory Sequences, Nucleic Acid ; Serotonin Plasma Membrane Transport Proteins* ; Serotonin* ; Synaptic Transmission ; Tandem Repeat Sequences

BACKGROUND/AIMS: α-Fetoprotein (AFP) is normally <10 ng/mL in adults without malignancy or liver regeneration. However, hereditary or nonhereditary persistence of AFP in healthy adults may be encountered in clinical practice. This study describes four cases of persistent AFP elevation in healthy adults and investigates mutations in key transcription regulatory regions of the AFP gene as potential drivers of AFP overexpression. METHODS: Four healthy adults with persistently elevated AFP levels (12.1 to 186.1 ng/mL) for >1 year, and 20 controls with low AFP levels (<0.61 to 2.9 ng/mL) were included in the study. AFP levels were collected from the families of two of the patients. We sequenced five regions that are critical for AFP expression: a promoter, two enhancers, and two silencers. RESULTS: One of the two cases in which family information was represented is the first case of hereditary persistence of AFP in South Korea. Mutations related to AFP overexpression were not found in the transcription regulatory regions among the four patients. CONCLUSIONS: Persistent AFP elevation is a heterogeneous condition with or without a hereditary pattern and may be caused by factors outside of transcription regulatory region changes. Further research on the mechanism of AFP elevation is needed.
Adult* ; alpha-Fetoproteins ; Biomarkers ; DNA Mutational Analysis ; Humans ; Korea ; Liver Regeneration ; Regulatory Sequences, Nucleic Acid

OBJECTIVETo construct a modified and enhanced thymidine kinase (TK) vector regulated by human telomerase catalytic subunit promoter (hTERT) promoter and cytomegalovirus (CMV) enhancer and its killing effect on nasopharyngeal carcinoma in vitro and in vivo and its safety in vivo.

METHODSThe pGL3-basic, as basic vector template, was linked and constructed into TK vector regulated by hTERT promoter and CMV enhancer with mono-promoter vector as control. Enhanced TK expression was confirmed by fluorescent microscopy and real time fluorescent quantitative PCR. Telomerase activity was measured by stretch PCR. Tumour killing effects were examined by MTT and Boyden areola. The effects of enhanced TK on the invasiveness of tumor cell NPC 5-8F and the growth of xenograft implanted in nude mice were investigated.

RESULTSCompared with non-enhanced vector, TK expressed by the enhanced vector significantly increased in NPC 5-8F and MCF-7 cells, telomerase activity was positive in human in NPC 5-8F cells and breast cancer MCF-7 cells and negative in control human blood vessel endothelium ECV-304 cells. After ganciclovir(GCV) treatment, NPC 5-8F cell survival rate and invasiveness decreased and tumor progress of NPC xenograft implanted in nude mice was inhibited, without obvious toxicity effects on mouse liver and kidney.

CONCLUSIONSThe enhanced TK vector regulated by hTERT promoter and CMV enhancer can obviously and specifically inhibit and kill nasopharyngeal carcinoma cells in culture and nasopharyngeal carcinoma xenograft in nude mice in vivo, without obviously toxic side effects on nude mice. The targeted and enhanced TK gene vector with high performance may be a new tumour targeted gene therapy strategy clinically to aim directly at most malignant tumours including nasopharyngeal carcinoma, with more extensive anti-cancer spectrum.

Animals ; Cell Line, Tumor ; Cell Survival ; Cytomegalovirus ; genetics ; Genetic Vectors ; Humans ; Mice ; Mice, Inbred BALB C ; Mice, Nude ; Nasopharyngeal Neoplasms ; therapy ; Promoter Regions, Genetic ; Regulatory Sequences, Nucleic Acid ; Telomerase ; genetics ; Thymidine Kinase ; genetics ; Transfection

OBJECTIVE: To explore the relationship between TK gene expression regulated by enhanced suicide gene vector and telomerase activity in nasopharyngeal carcinoma cells. METHOD: The reformed reconstructed enhanced vector, pGL3-basic-EGFP-TK-hTRETp-CMV enhancer, and hTERT mono-promoter vector, pGL3-basic-EGFP-TK-hTRETp(as controls), were transfected into telomerase(+) nasopharyngeal carcinoma 5-8F cell lines, telomerase(+) human breast cancer MCF-7 cell lines and telomerase(-) normal vascular endothelium cell lines respectively. TK gene green fluorescent protein was observed by fluorescence microscope. The expression of TK gene mRNA was measured by the real-time fluorescent quantified PCR and the telomerase activity was determined by the method of TRAP argentation in malignant tumour cells pre- and post-transfected by enhanced vector. Meanwhile the relationship between TK and telomerase was analyzed. RESULT: (1) A strong TK gene fluorescent show and TK mRNA expression were displayed after the enhanced suicide gene vector was transfected into nasopharyngeal carcinoma 5-8F cell lines and human breast cancer MCF-7 cell line, which were more stronger than those of mono-promoter group, pGL3-basic-EGFP-TK-hTRETp, and ECV cells transfected by enhanced suicide gene vector. Meanwhile,real-time fluorescent quantified PCR showed that the A value of enhanced vector group was higher than that of controls. (2) Telomerase activity after transfection of enhanced vector and GCV was lower than those before by the method of TRAP argentation in nasopharyngeal carcinoma cell lines,but no change in normal control cells after transfection of enhanced vector and GCV. (3) After adding GCV, the obvious inhibitory effect of tumour cells growth induced by pGL3-basic-EGFP-TK-hTRETp-CMV enhancer were observed in nasopharyngeal carcinoma 5-8F cell lines and human breast cancer MCF-7 cell line, which was higher than those of mono-promoter, pGL3-basic-EGFP-TK-hTRETp, pGL3-basic-EGFP3 and blank controls, but without inhibitory effect in ECV cells transfected by enhanced vector. CONCLUSION TK gene expression is regulated by hTERT promoter and CMV enhancer, and then the telomerase activity is reduced and the cancer cells are specifically killed. But it is unclear how the telomerase are down-regulated by TK gene.
Cell Death ; Cell Line ; Cell Line, Tumor ; Gene Expression Regulation ; Genes, Transgenic, Suicide ; Genetic Vectors ; Green Fluorescent Proteins ; genetics ; Humans ; Nasopharyngeal Neoplasms ; genetics ; metabolism ; Promoter Regions, Genetic ; Regulatory Sequences, Nucleic Acid ; Telomerase ; genetics ; metabolism ; Thymidine Kinase ; genetics ; Transfection

BACKGROUND: Thyroid Transcription Factor-1(TTF-1) acts as a tissue specific transcription factor in the regulation of lung specific gene expression and as morphogenic protein during lung organogenesis. Currently, there is very little information on the cis-acting sequences and transcription and transcription factors that direct the TTF-1 gene expression. DNAse 1 hypersensitive (DH) sites represent a marker for active or potentially active chromatin and are likely to be especially important in gene regulation, being associated with many DNA sequences that regulate gene expression. It is clear that DH regions correlate with genetic regulatory loci and binding for sequence-specific DNA-binding proteins. METHODS: We have used DH site assays to identify putative distal regulatory elements in H441 lung adenocarcinoma cells, which express the TTF-1 gene and HeLa cells. RESULTS: There are four DH sites 5' of the TTF-1 gene. These sites are located at base pair approximately +150, -450, -800, and -1500 from the start of transcription. CONCLUSION: These data suggest that there may be at least one intragenic site and regulatory region 5' prime to the promotor region.
Adenocarcinoma ; Base Pairing ; Base Sequence ; Chromatin ; Deoxyribonuclease I* ; Deoxyribonucleases* ; DNA-Binding Proteins ; Gene Expression ; HeLa Cells ; Humans ; Lung* ; Organogenesis ; Promoter Regions, Genetic ; Regulatory Sequences, Nucleic Acid ; Thyroid Gland ; Transcription Factors*