Fruit ripening is associated with a number of physiological and biochemical changes. They include degradation of chlorophyll, synthesis of flavor compounds, carotenoid biosynthesis, conversion of starch to sugars, cell wall solublisation and fruit softening. These changes are brought about by the expression of specific genes. People are interested in the molecular mechanism involved in the regulation of gene transcription during fruit ripening. Many fruit-specific promoters such as PG, E4, E8, and 2A11 have been characterized and shown to direct ripening-specific expression of reporter genes. AGPase plays the key role in catalyzing the biosynthesis of starch in plants. It is a heterotetrameric enzyme with two small subunits and two large subunits, which are encoded by different genes. In higher plants, small subunits are highly conserved among plant species and expressed in all tissues. And the large subunits are present at multiple isoforms and expressed in a tissue-specific pattern. In fruits, the expression pattern of the large subunits varies with plant species. That made it important to study the transcriptional regulation of the large subunits of AGPase in different plant species. Northern-blot analysis indicates in watermelon, an isoform of the large subunits Wml1 expressed specifically in fruits, not in leaves. The 5' flanking region of Wml1, which covers 1573bp, has been isolated through the method of uneven PCR. And transient expression assay has shown that the 1573bp (named WSP) can direct fruit-specific expression of GUS gene. Our goal in this study was to scan the promoter region for main regulatory regions involved in fruit-specific expression. A chimaeric gene was constructed containing the WSP promoter, the beta-glucuronidase (GUS) structural sequence as a reporter gene and the nopaline synthase polyadenylation site (NOS-ter). The plasmid pSPA was digested with Hind III + Hinc II and promoter fragment of 1573bp (from 180bp to 1752bp) was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-16. The same insert was then cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by HindIII + Bgl II to produce pISPA-16. Three 5'-end deletions of the promoter were obtained and fused to GUS gene in plant transient expression vector pBI426: the 1201bp fragment (from 551bp to 1752bp) was generated by digestion of pBSPA-16 with BamH I + SnaB I, the 898bp fragment (from 854bp to 1752bp) by BamH I + EcoRV. Both fragments were ligated with pBluescript SK(-) digested by BamH I + Sma I, to produce pBSPA-12 and pBS-PA-9. The inserts were cut out with HindmIII + BamH I and ligated with pBI426 digested by Hind III + Bgl II, to produce pISPA-12 and pISPA-9. The 795bp fragment (from 957bp to 1752bp) was generated by digestion of pSPA with Hinc II + EcoR I, promoter fragment was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-8. The same insert were cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by Hind III + Bgl II. The 1573bp fragment and three 5'-end deletions were delivered into watermelon leaf, stem, flower and fruit of different development stages (5, 10, 20 days after pollination) via particle bombardment using a biolistic PDS-1000/He particle gun. Bombardment parameters were as follows: a helium pressure of 1200 psi, vacuum of 91432.23Pa, 7 cm between the stopping screen and the plate. Histochemical assay were done on all the tissues bombarded after incubation for 2 days. The 1573bp fragment had the strongest promoter activity, and can induce GUS expression in fruits of 5 and 20 days after anthesis and flowers, but not in fruits of 10 days after anthesis, leaves and stems. Fragments of 1201bp and 898bp can induce GUS expression only in fruits of 20 days after anthesis, and with lower expression levels than 1573bp. Fragment of 795bp was not able to direct GUS expression in any of the tissues bombarded (data not shown). It can be concluded that of the 1573bp, 1201 bp, 898bp Wml1 5'flanking regions include the necessary information directing fruit-specific expression. Deletion from 180bp to 551bp doesn't affect the fruit-specificity of the promoter, but lowered the expression level. There may be some cis-acting elements located in this region, which can enhance external gene expression in later stages of fruit development. Deletion from 854bp and 958bp led to loss of GUS expression. This region includes the necessary information needed for gene expression as well as the regulatory elements for fruit-specific transcription.
Citrullus ; genetics ; Fruit ; genetics ; Gene Expression Regulation, Plant ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics ; physiology

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics

In excitable and endocrine organs, calcium influxes through the L-type voltage-gated calcium channel (VGCC) which is composed of four (alpha 1, alpha 2, beta, and gamma) subunits. Temporal and spatial expression of calcium channel activity is regulated by the transcription of alpha 1 subunit. To elucidate the genomic organization of the VGCC alpha 1D subunit gene, a genomic clone was isolated from the human genomic library and its sequence was analyzed. A 12 kb genomic clone contained the 5'-flanking regulatory region and first two exons was selected and the initiation site for alpha 1D mRNA synthesis was examined by primer extension analysis. The major initiation site was found at the -523 NT position in the translation initiation site. The TATA box could not be found above the transcription initiation site. The CAT vector construct containing the 2.5 kb upstream region had high CAT activity on transfection to NG108-15 and PC12 cells, which confers the neuronal expression of the alpha 1D gene.
Amino Acid Sequence ; Base Sequence ; Calcium Channels/genetics* ; Chloramphenicol O-Acetyltransferase/genetics ; Cloning, Molecular ; Gene Library ; Genetic Vectors ; Human ; Molecular Sequence Data ; Regulatory Sequences, Nucleic Acid* ; Restriction Mapping

OBJECTIVE: To explore the pathogenesis for a SRY-negative male with 46,XX disorder of sex development (DSD). METHODS: Peripheral blood samples of the patient and his family members were subjected to chromosomal karyotyping, routine PCR, real-time fluorescence quantitative PCR, whole exome sequencing and whole genome sequencing. The data was analyzed with NextGENe software. RESULTS: Both the proband and his brother presented a 46,XX karyotype with negative SRY gene, while their father presented normal phenotype and karyotype with positive SRY gene. No pathogenic variant associated with sex development was detected by whole exome sequencing, while a 243 kb duplication was detected by whole genome sequencing in the 5' upstream region of the SOX9 gene in the proband, his brother and father. The same duplication was not found in his sister and mother. CONCLUSION The 243 kb duplication at the 5' upstream of the SOX9 gene may predispose to the 46,XX DSD in this family. It is speculated that there exist an unknown core regulatory element in the upstream of the SOX9, and its duplication may trigger expression of SOX9 and initiate testicular differentiation in the absence of SRY gene.
Disorders of Sex Development/genetics* ; Female ; Humans ; Male ; Mutation/genetics* ; Regulatory Sequences, Nucleic Acid/genetics* ; Sex-Determining Region Y Protein/genetics* ; Testis ; Whole Exome Sequencing

OBJECTIVETo identify the causative mutations in two Chinese Han families featuring triphalangeal thumbs (TPT) and preaxial polydactyly (PPD).

METHODSBlood samples were collected from 9 members (2 affected) from family 1 and 14 members (7 affected) from family 2. After genomic DNA was extracted, the ZPA regulatory sequence (ZRS) region was analyzed with real-time quantitative PCR (qPCR) and Sanger sequencing. For family 1, haplotypes compassing the ZRS were also analyzed with short tandem repeats (STR) and single nucleotide changes.

RESULTSNo copy number mutation around the ZRS region was found in both families. Two heterogeneous mutations in the ZRS (406A>G and 105C>G) were found to co-segregate with the TPT/PPD malformation in family 1 and 2, respectively. Neither mutation was detected in 200 healthy individuals. Haplotype analysis and Sanger sequencing of family 1 indicated that the first TPT/PPD patient in the family was both germline and somatic mosaic for the 406A>G mutation.

CONCLUSIONTwo pathogenic ZRS mutations, 105C>G and 406A>G, have been identified in two Chinese Han families with TPT/PPD, among which the 406A>G mutation was de novo.

Asian Continental Ancestry Group ; genetics ; Female ; Hand Deformities, Congenital ; genetics ; Haplotypes ; Humans ; Male ; Mutation ; Polydactyly ; genetics ; Regulatory Sequences, Nucleic Acid ; Thumb ; abnormalities

UNLABELLED: OBJECTIVE; To determine the effect of a variation of CAG-rich region, which was found in the 5'-regulatory sequence of insulin receptor substrate-1(IRS-1) gene in Type 2 diabetes mellitus(T2DM) patients, on gene expression and its mechanism. METHODS: The recombinants, pGL2.P-T3 and pGL2.P-T5, were constructed with luciferase reporter vector, pGL2 promoter. T3 and T5 were wild-type and variant alleles, respectively. The recombinants were cotransfected with pSV-beta-galactosidase control vector to Hela cells. Luciferase assay was performed to assess transcriptional activity. The electrophoresis mobility shift assay(EMSA) and DNA footprint assay were applied to determine the interaction between the DNA regulatory sequences and nuclear proteins of Hela cells. RESULTS: The relative transcription activity of T5 was lower than that of T3 [(7.76+/-1.05)% vs (9.98+/-1.40)%, P<0.05]; EMSA showed both T3 and T5 formed a single retarded band in gel with the same mobility with nuclear proteins; T5 had 2 binding sites for transacting factors, CGCGCCCGCGGGCGGCGGC and GGGCGGCTGGTGGCGGCTG, which was the same as T3. CONCLUSION Although the variation in T5 do not alter the DNA-binding sites for Hela cell nuclear extracts, the notable decrease in gene transcription activity induced by it may be an important factor to the development T2DM in the carrier.
5' Flanking Region ; Diabetes Mellitus, Type 2 ; genetics ; Gene Expression ; Genetic Variation ; HeLa Cells ; Humans ; Insulin Receptor Substrate Proteins ; genetics ; Regulatory Sequences, Nucleic Acid

OBJECTIVES: To study the association of β2-drenergic receptor ( METHODS: A total of 143 children with asthma who attended the hospital from October 2016 to October 2020 were enrolled as the asthma group, among whom 61 children had mild symptoms (mild group) and 82 children had moderate-to-severe symptoms (moderate-to-severe group). A total of 137 healthy children were enrolled as the control group. Peripheral venous blood samples were collected from the two groups. The SNaPshot SNP technique was used to analyze the SNP and haplotypes of the RESULTS: Polymorphisms were observed in the CONCLUSIONS SNP/haplotype of the
Asthma/genetics* ; Case-Control Studies ; Child ; Genetic Predisposition to Disease ; Genotype ; Haplotypes ; Humans ; Polymorphism, Single Nucleotide ; Receptors, Adrenergic, beta-2/genetics* ; Regulatory Sequences, Nucleic Acid

OBJECTIVETo establish chromosome conformation capture (3C) strategy and to use this method for exploring the effect of chromosome conformation on human alpha-globin gene expression in the human alpha-globin transgenic mouse.

METHODSHomozygous human alpha-globin transgenic male mouse was crossed with KM female mouse. The 14.5-day post-coitum (dpc) embryos were used for the isolation of fetal liver and fetal brain cells. Homogeneous single-cell suspension was treated with formaldehyde to crosslink the chromatin conformation in the nuclear. The cross-linked chromatin compound was digested with Nco I and then ligated with T4 DNA ligase. The ligated compound was reversely cross-linked and then the ligated genomic DNA was purified for PCR analysis. The primers were designed along the two sides of cut and ligated sites. Semi-quantitative PCR was used to analyze the chromosome conformation of the whole human alpha-globin gene locus in fetal liver and fetal brain cells.

RESULTSWhen HS40 fragment was used as the fixed fragment, in fetal brain cells, the ligation frequencies of HS40 fragment with other fragments were decreased as the linear distances to HS40 fragment were increasing; while in fetal liver cells, two active genes (alpha1 and alpha2) fragments showed higher ligation frequencies with HS40 fragment than other fragments. However, the fragment containing an inactive gene (xi) displayed the comparable low ligation frequency as that in fetal brain. When alpha2 fragment was used as the fixed fragment, similarly, in fetal brain cells the ligation frequencies of alpha2 fragment with other ones were decreased as the linear distances increasing; when in fetal liver cells, it showed higher ligation frequencies with two upstream regulatory elements (HS 40 and 33). However, it showed a little bit lower ligation frequency with another two upstream regulatory elements (HS10 and 8) than those in fetal brain.

CONCLUSIONIn fetal liver cells, the distant regulatory elements are in close proximity to the downstream of the expressed globin genes through looping out, the interval region; however, in fetal brain, they were not in vicinity to the expressed globin genes.

Animals ; Brain ; metabolism ; Chromosomes, Artificial, Bacterial ; Chromosomes, Mammalian ; chemistry ; Female ; Gene Expression Regulation ; Humans ; Liver ; metabolism ; Male ; Mice ; Mice, Transgenic ; Nucleic Acid Conformation ; Regulatory Sequences, Nucleic Acid ; alpha-Globins ; biosynthesis ; genetics

We studied the influence of the first intron and 3'-regulatory region of ovalbumin gene (ov) on oviduct-specific transgene expression. The 3'-regulatory region in the oviduct-specific expression vector containing human tissue kallikrein (hK1) cDNA was replaced with bovine growth hormone (BGH) poly A, and the first intron was deleted by restriction enzyme digestion, resulting in five new vectors pOV2K, pOV3K, pOV4K, pOV5K and pOV6K. After mixing with polyethylenimine, we injected same copies of the five vectors via wing vein route into laying hens and compared their expression levels by quantitative assay for enzymatic activities in the egg whites. Among the five vectors tested, the pOV2K containing both the 5'- and 3'-regulatory regions expressed highest level of rhK1 activity, followed by pOV3K with the 3'-regulatory region replaced with BGH poly A, and then by the first intron-shortened vectors pOV4K, pOV5K and pOV6K. These data suggest that both the first intron and 3'-regulatory region of ov gene have enhancing effect on transgene expression in oviduct cells, which should be included in oviduct-specific expression vectors.
Animals ; Animals, Genetically Modified ; Cattle ; Chickens ; Cloning, Molecular ; Female ; Gene Transfer Techniques ; Growth Hormone ; genetics ; Humans ; Introns ; genetics ; Ovalbumin ; genetics ; Oviducts ; metabolism ; Recombinant Proteins ; biosynthesis ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics ; Tissue Kallikreins ; genetics ; Transgenes ; genetics

OBJECTIVETo investigate the mechanism of cytokeratin 13 (CK13) gene expression control and the effects of different motifs of CK13 gene 5' flanking region on its transcriptional activity.

METHODSThe molecular clone technique and reporter gene analysis were used to assay the effects of different motifs of 513 bp of CK13 gene 5' flanking region on its transcriptional activity. The pCAT enhancer vectors with different motifs of CK13 gene 5' flanking region were constructed and transferred to HeLa cells with the help of lipofectin. The instant CAT expression of different clones was detected and the effects of different motifs of the CK13 gene 5' flanking region on its transcriptional activity were evaluated.

RESULTS119 bp from -nt.325 to -nt.207 upstream of the first ATG of CK13 gene 5' flanking region included a silent element. 113 bp region from -nt.206 to -nt.94 included an enhanced element.

CONCLUSION513 bp of CK13 gene 5' flanking region includes a silent element and an enhanced element. Further locating these cis elements and detecting the related trans reaction factors may unveil some important clues to the details of the mechanisms for the CK13 gene expression and tissue-specific expression.

5' Flanking Region ; genetics ; Base Sequence ; Chloramphenicol O-Acetyltransferase ; genetics ; metabolism ; Enhancer Elements, Genetic ; genetics ; HeLa Cells ; Humans ; Keratins ; genetics ; Molecular Sequence Data ; Recombinant Fusion Proteins ; genetics ; metabolism ; Regulatory Sequences, Nucleic Acid ; genetics ; Transcription, Genetic ; genetics ; Transfection ; methods