To understand the mechanism of transcriptional regulation, it is essential to detect promoters and regulatory elements. Various kinds of methods have been introduced to improve the prediction accuracy of regulatory elements. Since there are few experimentally validated regulatory elements, previous studies have used criteria based solely on the level of scores over background sequences. However, selecting the detection criteria for different prediction methods is not feasible. Here, we studied the calibration of thresholds to improve regulatory element prediction. We predicted a regulatory element using MATCH, which is a powerful tool for transcription factor binding site (TFBS) detection. To increase the prediction accuracy, we used a regulatory potential (RP) score measuring the similarity of patterns in alignments to those in known regulatory regions. Next, we calibrated the thresholds to find relevant scores, increasing the true positives while decreasing possible false positives. By applying various thresholds, we compared predicted regulatory elements with validated regulatory elements from the Open Regulatory Annotation (ORegAnno) database. The predicted regulators by the selected threshold were validated through enrichment analysis of muscle-specific gene sets from the Tissue-Specific Transcripts and Genes (T-STAG) database. We found 14 known muscle-specific regulators with a less than a 5% false discovery rate (FDR) in a single TFBS analysis, as well as known transcription factor combinations in our combinatorial TFBS analysis.
Binding Sites* ; Calibration ; Regulatory Sequences, Nucleic Acid ; Transcription Factors*

BACKGROUND/AIMS: α-Fetoprotein (AFP) is normally <10 ng/mL in adults without malignancy or liver regeneration. However, hereditary or nonhereditary persistence of AFP in healthy adults may be encountered in clinical practice. This study describes four cases of persistent AFP elevation in healthy adults and investigates mutations in key transcription regulatory regions of the AFP gene as potential drivers of AFP overexpression. METHODS: Four healthy adults with persistently elevated AFP levels (12.1 to 186.1 ng/mL) for >1 year, and 20 controls with low AFP levels (<0.61 to 2.9 ng/mL) were included in the study. AFP levels were collected from the families of two of the patients. We sequenced five regions that are critical for AFP expression: a promoter, two enhancers, and two silencers. RESULTS: One of the two cases in which family information was represented is the first case of hereditary persistence of AFP in South Korea. Mutations related to AFP overexpression were not found in the transcription regulatory regions among the four patients. CONCLUSIONS: Persistent AFP elevation is a heterogeneous condition with or without a hereditary pattern and may be caused by factors outside of transcription regulatory region changes. Further research on the mechanism of AFP elevation is needed.
Adult* ; alpha-Fetoproteins ; Biomarkers ; DNA Mutational Analysis ; Humans ; Korea ; Liver Regeneration ; Regulatory Sequences, Nucleic Acid

The aim of synthetic biology is to design artificial biological systems for novel applications. From an engineering perspective, construction of biological systems of defined functionality in a hierarchical way is fundamental to this emerging field. Here, we highlight some current advances on design of several basic building blocks in synthetic biology including the artificial gene control elements, synthetic circuits and their assemblies into devices and modules. Such engineered basic building blocks largely expand the synthetic toolbox and contribute to our understanding of the underlying design principles of living cells.
Gene Regulatory Networks ; Genes, Synthetic ; Genetic Engineering ; methods ; Models, Biological ; Proteins ; chemistry ; Regulatory Sequences, Nucleic Acid ; Synthetic Biology ; methods

Fruit ripening is associated with a number of physiological and biochemical changes. They include degradation of chlorophyll, synthesis of flavor compounds, carotenoid biosynthesis, conversion of starch to sugars, cell wall solublisation and fruit softening. These changes are brought about by the expression of specific genes. People are interested in the molecular mechanism involved in the regulation of gene transcription during fruit ripening. Many fruit-specific promoters such as PG, E4, E8, and 2A11 have been characterized and shown to direct ripening-specific expression of reporter genes. AGPase plays the key role in catalyzing the biosynthesis of starch in plants. It is a heterotetrameric enzyme with two small subunits and two large subunits, which are encoded by different genes. In higher plants, small subunits are highly conserved among plant species and expressed in all tissues. And the large subunits are present at multiple isoforms and expressed in a tissue-specific pattern. In fruits, the expression pattern of the large subunits varies with plant species. That made it important to study the transcriptional regulation of the large subunits of AGPase in different plant species. Northern-blot analysis indicates in watermelon, an isoform of the large subunits Wml1 expressed specifically in fruits, not in leaves. The 5' flanking region of Wml1, which covers 1573bp, has been isolated through the method of uneven PCR. And transient expression assay has shown that the 1573bp (named WSP) can direct fruit-specific expression of GUS gene. Our goal in this study was to scan the promoter region for main regulatory regions involved in fruit-specific expression. A chimaeric gene was constructed containing the WSP promoter, the beta-glucuronidase (GUS) structural sequence as a reporter gene and the nopaline synthase polyadenylation site (NOS-ter). The plasmid pSPA was digested with Hind III + Hinc II and promoter fragment of 1573bp (from 180bp to 1752bp) was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-16. The same insert was then cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by HindIII + Bgl II to produce pISPA-16. Three 5'-end deletions of the promoter were obtained and fused to GUS gene in plant transient expression vector pBI426: the 1201bp fragment (from 551bp to 1752bp) was generated by digestion of pBSPA-16 with BamH I + SnaB I, the 898bp fragment (from 854bp to 1752bp) by BamH I + EcoRV. Both fragments were ligated with pBluescript SK(-) digested by BamH I + Sma I, to produce pBSPA-12 and pBS-PA-9. The inserts were cut out with HindmIII + BamH I and ligated with pBI426 digested by Hind III + Bgl II, to produce pISPA-12 and pISPA-9. The 795bp fragment (from 957bp to 1752bp) was generated by digestion of pSPA with Hinc II + EcoR I, promoter fragment was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-8. The same insert were cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by Hind III + Bgl II. The 1573bp fragment and three 5'-end deletions were delivered into watermelon leaf, stem, flower and fruit of different development stages (5, 10, 20 days after pollination) via particle bombardment using a biolistic PDS-1000/He particle gun. Bombardment parameters were as follows: a helium pressure of 1200 psi, vacuum of 91432.23Pa, 7 cm between the stopping screen and the plate. Histochemical assay were done on all the tissues bombarded after incubation for 2 days. The 1573bp fragment had the strongest promoter activity, and can induce GUS expression in fruits of 5 and 20 days after anthesis and flowers, but not in fruits of 10 days after anthesis, leaves and stems. Fragments of 1201bp and 898bp can induce GUS expression only in fruits of 20 days after anthesis, and with lower expression levels than 1573bp. Fragment of 795bp was not able to direct GUS expression in any of the tissues bombarded (data not shown). It can be concluded that of the 1573bp, 1201 bp, 898bp Wml1 5'flanking regions include the necessary information directing fruit-specific expression. Deletion from 180bp to 551bp doesn't affect the fruit-specificity of the promoter, but lowered the expression level. There may be some cis-acting elements located in this region, which can enhance external gene expression in later stages of fruit development. Deletion from 854bp and 958bp led to loss of GUS expression. This region includes the necessary information needed for gene expression as well as the regulatory elements for fruit-specific transcription.
Citrullus ; genetics ; Fruit ; genetics ; Gene Expression Regulation, Plant ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics ; physiology

Genome-wide association studies (GWASs) have greatly contributed to the identification of common variants responsible for numerous complex traits. There are, however, unavoidable limitations in detecting causal and/or rare variants for traits in this approach, which depends on an LD-based tagging SNP microarray chip. In an effort to detect potential casual and/or rare variants for complex traits, such as type 2 diabetes (T2D) and triglycerides (TGs), we conducted a targeted resequencing of loci identified by the Korea Association REsource (KARE) GWAS. The target regions for resequencing comprised whole exons, exon-intron boundaries, and regulatory regions of genes that appeared within 1 Mb of the GWA signal boundary. From 124 individuals selected in population-based cohorts, a total of 0.7 Mb target regions were captured by the NimbleGen sequence capture 385K array. Subsequent sequencing, carried out by the Roche 454 Genome Sequencer FLX, generated about 110,000 sequence reads per individual. Mapping of sequence reads to the human reference genome was performed using the SSAHA2 program. An average of 62.2% of total reads was mapped to targets with an average 22X-fold coverage. A total of 5,983 SNPs (average 846 SNPs per individual) were called and annotated by GATK software, with 96.5% accuracy that was estimated by comparison with Affymetrix 5.0 genotyped data in identical individuals. About 51% of total SNPs were singletons that can be considered possible rare variants in the population. Among SNPs that appeared in exons, which occupies about 20% of total SNPs, 304 nonsynonymous singletons were tested with Polyphen to predict the protein damage caused by mutation. In total, we were able to detect 9 and 6 potentially functional rare SNPs for T2D and triglycerides, respectively, evoking a further step of replication genotyping in independent populations to prove their bona fide relevance to traits.
Cohort Studies ; Exons ; Genome ; Genome-Wide Association Study ; Humans ; Korea ; Polymorphism, Single Nucleotide ; Regulatory Sequences, Nucleic Acid ; Triglycerides

In excitable and endocrine organs, calcium influxes through the L-type voltage-gated calcium channel (VGCC) which is composed of four (alpha 1, alpha 2, beta, and gamma) subunits. Temporal and spatial expression of calcium channel activity is regulated by the transcription of alpha 1 subunit. To elucidate the genomic organization of the VGCC alpha 1D subunit gene, a genomic clone was isolated from the human genomic library and its sequence was analyzed. A 12 kb genomic clone contained the 5'-flanking regulatory region and first two exons was selected and the initiation site for alpha 1D mRNA synthesis was examined by primer extension analysis. The major initiation site was found at the -523 NT position in the translation initiation site. The TATA box could not be found above the transcription initiation site. The CAT vector construct containing the 2.5 kb upstream region had high CAT activity on transfection to NG108-15 and PC12 cells, which confers the neuronal expression of the alpha 1D gene.
Amino Acid Sequence ; Base Sequence ; Calcium Channels/genetics* ; Chloramphenicol O-Acetyltransferase/genetics ; Cloning, Molecular ; Gene Library ; Genetic Vectors ; Human ; Molecular Sequence Data ; Regulatory Sequences, Nucleic Acid* ; Restriction Mapping

Monocyte chemoattractant protein-1 (MCP-1) plays an important role in cardiovascular disease (CVD). Genetic polymorphism in the regulatory regions of MCP-1 could affect MCP-1 expression. The purpose of the study was to explore the possible association of MCP-1 -2518 A/G genetic polymorphism and CVD risk factors in the elderly Korean population. Dietary, anthropometric, and biochemical factors were assessed in 168 subjects. The frequency of A/A, G/A, and G/G genotypes was 14.2%, 45.8%, and 40.0%, respectively. The blood level of MCP-1 was significantly higher in subjects with A/A genotype. The MCP-1 level was significantly higher in A/A genotype with hypercholesterolemia than in other genotypes. Meat intake and percent energy from lipids were significantly positively correlated with the MCP-1 level, especially, stronger in A/A genotype. In the stepwise discriminant analysis, TNF-alpha level, meat intake, HDL-C were associated with MCP-1 in all subjects (model R2 = 24%). TNF-alpha level, sugar intake, cholesterol intake, and meat intake affected MCP-1 in A/A genotype (model R2 = 82%), but not in G/A or G/G. In conclusion, subjects possessing A/A genotype exhibited higher levels of MCP-1 than other genotypes in Korean elders. Further, meat, sugar, and cholesterol intakes affected the MCP-1 level. Therefore, the decrement of meat, sugar, and cholesterol intakes helps to normalize the MCP-1 level and can decrease CVD risk in A/A genotype.
Aged* ; Cardiovascular Diseases* ; Chemokine CCL2 ; Cholesterol ; Genotype ; Humans ; Hypercholesterolemia ; Meat ; Polymorphism, Genetic ; Regulatory Sequences, Nucleic Acid ; Risk Factors* ; Tumor Necrosis Factor-alpha

PURPOSE: Although it is now generally accepted that human papillomaviruses (HPVs) are causally related to cervical neoplasia by plentiful epidemioiogic and experimental works, little is known about the direct evidence of sexual transmission of HPV. This study was undertaken to confirm the transmission route and determine the infectivity of HPV by comparison of HPV 16 sequence variations at upstream regulatory region (URR) in the couples of patient with cervical cancer. MATERIALS AND METHODS: HPV DNAs obtained from genital lesions of forty married couples of patients with cervical cancer were evaluated by polymerase chain reaction (PCR) and PCR-directed sequencing. RESULTS: HPV 16 was detected in fourteen (63.6%) of twenty-two male consorts whose wives were positive for HPV 16. Of these, six (42.9%) couples demonstrated identical HPV 16 URR variants between patients and male consorts, and eight had mismatching HPV 16 URR sequences. Among six couples showed matching HPV 16 variants, three couples mamed for 10, 19, 25 years respectively carried variant 7728/7779, two couples married for 15 years each carried variant 7728/7762, and one couple married for 18 years carried variant 7728/7797, CONCLUSION: These data suggest that sexual transmission of HPV 16 does occur. A search for more HPV variants in a large cohort is needed to secure high level of precision in molecular epidemiologic study using HPV variant.
Cohort Studies ; DNA ; Epidemiologic Studies ; Family Characteristics* ; Human papillomavirus 16* ; Humans ; Male ; Molecular Epidemiology ; Polymerase Chain Reaction ; Regulatory Sequences, Nucleic Acid* ; Spouses ; Uterine Cervical Neoplasms*

DNA microarray and next-generation sequencing provide data that can be used for the genetic analysis of multiple quantitative traits such as gene expression levels, transcription factor binding profiles, and epigenetic signatures. In particular, chromatin opening is tightly coupled with gene transcription. To understand how these two processes are genetically regulated and associated with each other, we examined the changes of chromatin accessibility and gene expression in response to genetic variation by means of quantitative trait loci mapping. Regulatory patterns commonly observed in yeast and human across different technical platforms and experimental designs suggest a higher genetic complexity of transcription regulation in contrast to a more robust genetic architecture of chromatin regulation.
Chromatin* ; Epigenesis, Genetic ; Epigenomics ; Gene Expression ; Genetic Variation ; Humans ; Oligonucleotide Array Sequence Analysis ; Quantitative Trait Loci ; Regulatory Sequences, Nucleic Acid ; Research Design ; Transcription Factors ; Yeasts

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics