OBJECTIVETo establish human heart valve interstitial cells calcification culture model in vitro, and observe the effect of bone morphogenetic protein-2 (BMP-2) on calcification of human heart valve interstitial cells.

METHODSHuman heart valve interstitial cells were cultured in vitro, and divided into control group: cells were cultured in conventional media plus recombinant human BMP-2 treatment and experimental group: besides above treaments, calcification inducers ( recombinant human BMP-2, β-glycerophosphate, L-ascorbic acid, dexamethasone) were added to the culture media. The two group of cells were cultured for 14 days and were stained by Von Kossa, then the cell calcification was observed in this valvular interstitial cells calcification culture model in vitro. Protein expression of intercellular adhesion molecule 1 (ICAM-1), interleukin 8, BMP-2 and BMP-4 was determined by Western blot and BMP-2 secretion was measured by ELISA.

RESULTSIn the control group, the structure of human heart valve interstitial cells was clear, and the spindle and radial growth shaped cellular morphology was visible, and Von Kossa staining was negative. In the experimental group, the nuclei become darker in color, and granular sediment distribution was seen surrounding cells, and Von Kossa staining was positive, the cells were forming nodules of calcification. The protein expression of ICAM-1, interleukin 8, BMP-2 and BMP-4 in the experimental was significantly higher than that of the control group (all P < 0.05). The expression of BMP-2 in the experimental group was also significantly higher than that in control group ((92.5 ± 4.9) pg/ml vs. (22.2 ± 1.9) pg/ml, P < 0.05).

CONCLUSIONHuman BMP-2, β-glycerophosphate, L-ascorbic acid, and dexamethasone can induce human heart valve interstitial cells calcification and enhance inflammation in vitro by stimulating the secretion of BMP-2.

Ascorbic Acid ; Bone Morphogenetic Protein 2 ; Calcinosis ; Cells, Cultured ; Glycerophosphates ; Heart Valve Diseases ; Humans ; Recombinant Proteins ; Transforming Growth Factor beta

Objective To study the microstructural and ultrastructural changes of the epididymis of experimental varicocele in adolescent rats and it's role in infertility resulting from varicocele. Methods A varicocele model was performed in adolescent Sprague Dawley rats by partially ligating the left renal vein,the different segments of the epididymides of the rats were prepared for light and electron microscopy,the microstructure and ultrastructure of the epididymis were studied. Results There were lesions of different degree and segment specific changes in the epididymis with varicocele.Light microscopically,the main changes were interstitial vascular hyperemia,lymphocytes infiltration,sperm granuloma developed in the interstitial;The structure of the columnar epithelia was anomalies,epithelial cells degeneration,even the vacuoles appeared in the epithelial cells.The number of halo and clear cells increased.Inside the cavity of the duct,there were shedding cells,macrophage,deformed sperms and residual bodies.Electron microscopically,numerous large lysosomes,the residual bodies,the defected main cellular organelles(e.g. the endoplasmic reticulum,the mitochondrion and the Golgi complex etc.)and even large clear vacuoles were presented in the cytoplasm of principal cells.Clear cells were filled with lysosomes that made them frequently bulging into the lumen.The microvilli of the columnar epithelia were sparse and showed local defects.The thickness of the basal membrane increased.Conclusion\ The experimental varicocele in adolescent rats lead to microstructure and ultrastructure lesions in the epididymis,which may be another important reason of infertility resulting from varicocele.\;[

Objective:To evaluate the effect of anatomic resection (AR) and nonanatomic resection (NAR) on the prognosis of hepatocellular carcinoma (HCC) patients of China Liver Cancer Staging (CNLC) Ⅰa.Methods:PubMed, Embase and Cochrane Library databases were searched for articles on AR and NAR of CNLC Ⅰa stage HCC from January 2000 to March 2021. A meta-analysis was performed on patient characteristics, tumor characteristics, surgical procedures, postoperative pathological characteristics and long-term prognosis.Results:Of 9 case-control studies were included in this study, there were 2761 patients, with 1727 cases in the AR group and 1034 cases in the NAR group. When compared with the NAR group, the AR group had lower proportion of liver cirrhosis, lower ICG R15 value, higher proportion of Child-Pugh A grade, larger tumor diameter, higher proportion of microvascular invasion, longer operation time and higher intraoperative blood loss. The AR group had a better postoperative 5-year disease-free survival rate [ OR=1.54, 95% CI: 1.30-1.82, P<0.001] and a higher postoperative 5-year overall survival rate [ OR=1.27, 95% CI: 1.04-1.55, P=0.018]. Conclusion:AR is significantly better than NAR for preventing long-term recurrence and improving long-term survival in patients with CNLC Ⅰa stage HCC.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Objective:To retrospectively analyze clinical efficacy and safety of omalizumab in the treatment of chronic urticaria (CU) in southern Zhejiang, China.Methods:A retrospective observational study was conducted on CU patients who received omalizumab treatment at the First Affiliated Hospital of Wenzhou Medical University from January 1st, 2018 to August 1st, 2021. Through the outpatient follow-up visits, the disease activity, condition control, and quality of life were evaluated using the 7-day urticaria activity score (UAS7) , urticaria control test (UCT) , and dermatology life quality index (DLQI) . In addition, changes in disease condition, recurrence after withdrawal, and adverse events were assessed. Independent-sample t test was used for intergroup comparisons of normally distributed measurement data, Wilcoxon signed-rank sum test or Kruskal-Wallis H test was used for comparisons of non-normally distributed measurement data, and chi-square test or Fisher′s exact test was used for comparisons of enumeration data. Results:A total of 252 CU patients with poor response to antihistamines were included, with a baseline UCT score of 5.0 ± 2.4 points, a UAS7 score of 25.6 ± 6.2 points, and a DLQI score of 17.5 ± 4.7 points; among them, 204 (81.0%) were treated with omalizumab at an initial dose of 300 mg, and 48 (19.0%) with omalizumab at an initial dose of 150 mg. At the end points (12.0 ± 1.4 months after the start of treatment) , an overall control rate of 90.3% (224/248) was achieved after the omalizumab treatment; concretely, 137 (55.2%) patients achieved complete control (UCT = 16 points) , 87 (35.1%) achieved partial control (12 points ≤ UCT < 16 points) , and 24 (9.7%) showed no response (UCT < 12 points) , while 10 with partial response shifted to complete control after dose increase. During the treatment period, recurrence occurred in 50 patients (36.5%) , of whom 32 patients opted for retreatment with omalizumab, and then 30 (93.8%) achieved partial or complete control. Adverse events were reported in 8 patients (3.2%) , and all were mild or moderate.Conclusion:Omalizumab was effective in the real-world treatment of CU, and could improve patients′ quality of life, with a favorable safety profile.

Interactions between chromatin segments play a large role in functional genomic assays and developments in genomic interaction detection methods have shown interacting topological domains within the genome. Among these methods, Hi-C plays a key role. Here, we present the Genome Interaction Tools and Resources (GITAR), a software to perform a comprehensive Hi-C data analysis, including data preprocessing, normalization, and visualization, as well as analysis of topologically-associated domains (TADs). GITAR is composed of two main modules: (1) HiCtool, a Python library to process and visualize Hi-C data, including TAD analysis; and (2) processed data library, a large collection of human and mouse datasets processed using HiCtool. HiCtool leads the user step-by-step through a pipeline, which goes from the raw Hi-C data to the computation, visualization, and optimized storage of intra-chromosomal contact matrices and TAD coordinates. A large collection of standardized processed data allows the users to compare different datasets in a consistent way, while saving time to obtain data for visualization or additional analyses. More importantly, GITAR enables users without any programming or bioinformatic expertise to work with Hi-C data. GITAR is publicly available at http://genomegitar.org as an open-source software.
Animals ; Chromatin ; chemistry ; Computer Graphics ; Genome ; Genomics ; methods ; Humans ; Mice ; Software

Objective:To explore the clinical efficacy and safety of different surgical procedures of Mayo level Ⅳ inferior vena cava tumor thrombus(IVC-TT).Methods:The clinical and pathological data of 36 patients with Mayo level Ⅳ tumor thrombus were collected in three large clinical centers in China, including 18 cases in PLA General Hospital, 7 cases in Nanfang Hospital, and 11 cases in Renji Hospital. There were 25 males and 11 females.The median age was 56.5 years (53-67 years old). The average body mass index was 24.18±2.55 kg/m 2. The average diameter of renal tumors was 8.24±3.25 cm. The average length of inferior vena cava tumor thrombus was 12.89±2.50 cm. Mayo level Ⅳ tumor thrombus were divided into level Ⅳa and level Ⅳb (301 classification) based on the criterion of whether the proximal end of the thrombus has invaded the right atrium. Among them, level Ⅳa patients underwent robot-assisted inferior vena cava thrombectomy without cardiopulmonary bypass(CPB-free group, 6 cases). Level Ⅳb patients underwent robot-assisted inferior vena cava thrombectomy with cardiopulmonary bypass(CPB group, 12 cases) or cardiopulmonary bypass with deep hypothermic circulatory arrest assisted inferior vena cava thrombectomy(CPB/DHCA group, 18 cases). The baseline data of the three groups of patients were comparable. The perioperative results and long-term survival data after surgery were compared with different surgical methods for grade Ⅳcancer thrombosis. Results:All operations were successfully completed. Compared with the CPB group, the CPB-free group had a shorter first portal blocking time[17.5(15-36)min vs. 36.5(12-102)min, P=0.044], less intraoperative bleeding [2 350(1 000-3 000)ml vs. 3 500 (1 500-12 000)ml, P=0.043] and a lower allogeneic blood transfusion [1 250(500-2 000)ml vs. 2 185(700-5 800)ml, P=0.049]. Compared with the CPB/DHCA group, the CPB-free group had an advantage in reducing intraoperative allogeneic blood transfusion [1 250(500-2 000)ml vs. 2 700(1 200-10 000)ml, P=0.003]. There were no significant differences between groups in terms of duration of surgery and postoperative hospital stay. Among the 36 patients in this group, 23(64%) developed major complications (level Ⅲ or above), including 9 (25%) grade Ⅲ, 12 (33%) grade Ⅳ, and 2 (6%) grade Ⅴ. The CPB-free group had a relatively low complication rate of grade Ⅳ or above [ 17% (1/6) vs.42% (5/12) vs.44% (8/18)]. There were no statistical differences in median progression-free survival (16.4 vs.12.3 vs.18.0 months, P=0.695) and overall survival (30.1 vs.30.2 vs.37.7 months, P=0.674) between the groups. Conclusions:Robot-assisted inferior vena cava thrombectomy without cardiopulmonary bypass has the advantages of short ischemia time of organs, less intraoperative bleeding, and low incidence of major complications, which can be used as a safe and feasible surgical strategy for selected level Ⅳ tumor thrombus.