Objective To investigate the distribution and genetic characteristic of etiological agents among children with hand,foot and mouth disease(HFMD)in Shanghai and neighbor areas in 2008.Methods Throat swabs were collected from the inpatients with HFMD from May to June 2008 in Pediatrics Hospital affiliated to Fudan University,Shanghai,and Deqing,Zhejiang Province.Cerebral spinal fluid(CSF)from some patients were collected as well.Vero,MRC-5 and RD ceils were used to isolate the possible pathogens by observing cytopathic effect(CPE).Enterovirus genus,Coxsaekie virus group A type 16(CoxA16)and enterovirus type 71(EV71)were detected by reverse transcriptase-polymerase chain reaction(RT-PCR),and finally identified by sequencing.Results A total of 107 swabs and 22 CSF samples were collected from all 100 inpatients.Swabs of 50 children caused CPE observed.Among them,enteroviruses accounted for 74.0%(37/50),which including 26 (52.0%)of EV71,10(20%)of CoxAl6 and 1(2.0%)of CoxB3,and 13(26.0%)of other pathogens.All the 26 EV71 strains were similar with the isolates from Zhejiang Province and Fuyang,Anhui Province in 2008,which belonged tO genotype Cl all the 10 CoxAl6 strains belonged to genetic lineages C.Conclusions The causative agents of HFMD are complicated.CoxA16 and EV71 are predominant among children with HFMD in Shanghai and neighbor areas in 2008,while the pathogens of some patients are still unknown.

Objective To evaluate the survival ability of enterovirus 71 (EV71) on different surface and under different climate.Methods Each 1 × 105 tissue culture infective dose 50 (TCID50)EV71 was added on different aseptic surface of plastic,rubber,cloth and wood,respectively.Then these materials were put into biotron (artificial climatic chamber) which could simulate different temperature and moisture.The viruses were recovered after a definite time and then inoculated into Vero cell.The cytopathic effect (CPE) was observed everyday to survey the survival ability of EV71 on different medium surface.Results The recovery rates of EV71 on medium surface ranged from 89 ％-93 ％.The survival time of EV71 on medium surface varied under different climatic conditions.The longest survival time of the virus was observed under the condition of 20 ℃ as the temperature and 80％ as the humidity.After 24 hours of incubation,the infectious titer on plastic surface reduced about 4 lg.After 72 hours of incubation,the infectious titer reduced at least 3.89 lg on cloth and wood surface.Conclusions Temperature and humidity can affect the survival time of EV71 on medium surface,which is longer in the condition of low temperature and high humidity.The survival ability of EV71 on natural cloth and wood surface is better than that on synthetic plastic surface.

Objective To know the levels of antibodies against influenza A virus subtypes H1 and H3 of population in Shanghai during 2009, and the detection of antibodies against avian influenza virus subtypes H5 and H9 in population which contacts with avian. Methods The serological survey of the antibodies against influenza A viruses subtypes H1, H3, H5 and H9 in 356 close contacts with avian (professional population) and 332 general subjects (general population) at various age groups were carried out using hemagglutinin inhibit (HI) test. Results The positive rates of antibodies against influenza virus A/Brisbane/59/2007 (H1N1) in general population and professional population were 82.8% (275/332) and 73.9% (263/356), respectively; those of A/Brisbane/10/2007 (H3N2)were 50.6% (168/332) and 54.8% (195/356), respectively. The positive rate of antibodies against influenza virus A/Brisbane/59/2007 (H1N1 )was significantly higher than that of influenza A viruses subtype H3, which was consistent with etiological survey of influenza virus in Shanghai during 2008.The positive rates of antibodies against influenza A virus subtype H5 in professional population and general population were 4.2% (15/356) and 0.3% (1/332), respectively; those of influenza A virus subtype H9 were 34.6% (123/356) and 2.4% (8/332), respectively. The positive rates of antibodies against influenza virus A/Brisbane/59/2007 (H1N1 ) and A/Brisbane/10/2007 (H3N2) in age groups of 6 months-5 years and ≥60 years were lower than other age groups. Conclusions The immune protective response against seasonal influenza A subtype H1 and H3 of population in Shanghai is high,while those of children and the elders were low. The levels of antibodies against influenza A viruses subtype H5 and H9 in professinal population present obviously ascending trend, which indicates that the etiological and serological survey of influenza virus in this population should be enhanced.

The theories of "absence of kidney excess syndrome" and "treating kidney disease only by the tonifying method without the purgative method" have been highly praised by medical practitioners throughout history. However,the syndrome of intermingled deficiency and excess of kidney in clinical practice is not uncommon,and there are many cases that treating kidney disease with the method of expelling kidney turbidity. However,its theoretical basis has not been systematically organized and studied. This article,based on the consideration of the "three purging" herbs of Liuwei Dihuang Pill,finds that "kidney" in traditional Chinese medicine not only stores essence,but also removes turbidity. From the theory of storage-expelling of five zang viscera,the physiological characteristic of kidney is integrated with storing and expelling functions. In addition to storing essence and qi to maintain normal life activities in the human body,it also exercises the function of excretion through the bladder and sanjiao. Under pathological conditions,both the function of storing essence and excretion of turbidity in kidney can be affected,which manifests as lack of essence and accumulation of turbidity. The pathological features of this disease are characterized by kidney qi deficiency as the root cause,accumulation of turbidity as the result,and intertwined with each other. Based on the physiology and pathology of visceral manifestation of kidney in traditional Chinese medicine,the theory of "retaining essence and removing turbidity" can be used in the clinical diagnosis and treatment of kidney disease. When treating kidney disease,the method of invigorating the kidney can also be combined with the method of expelling kidney turbidity,such as promoting diuresis,dissipating phlegm,promoting blood circulation,or removing toxin. Flexible selection of the above treatment methods can improve the therapeutic effect.

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics

Objective To understand the epidemiological characteristics and related risk factors on HIV,HBV infection of people from the southwest province of China and to provide basic data for the development of related strategies.Methods According to the information on current HIV epidemics,one township from the area was selected as the study field and all the adult population were surveyed using a questionnaire to collect social demographic data and information on infection-related factors.Results A total of 2 290 adults were investigated and data showed as follows:the average HIV infection rate as 7.9％,the average HBV infection rate as 3.1％,and the average HIV/HBV co-infection rate as 1.2％.As for HIV infection,people whose yearly family gross income between 1 000 and 3 000 Yuan (OR=0.28) or more than 5 000 Yuan (OR=0.14) were less likely to be infected with HIV than those people whose annual family gross income less than 1 000 Yuan.People with educational level of primary school and above were more likely to carry HIV than those who were illiterate (OR =3.28).People who had the history of migration were less likely to carry HIV than those who had not (OR=0.33).People who had the history of being drug abusers were more likely to infect HIV than those who had not (OR=46.32).People whose spouses had the history of using drugs were more likely to infect HIV than those who had not (OR=3.52).People whose spouses had been infected with HIV were more likely to infect HIV than those who had not (OR=9.56).As for HBV infection,people who had the history of migration were more likely to infect HBV (OR =2.48).As for HIV/HBV co-infection,people whose spouses had the history of HIV infection were more likely to infect HIV/HBV co-infection than others who did not have the history (OR=6.04).Conclusion There had been a serious HIV/AIDS epidemic in our study field.Other than taking measures as detection and vaccination on HBV,health education should be strengthened,together with measurements as needle exchange and methadone substitution therapy,to control the spread of AIDS.

ObjectiveTo assess the coverage and effectiveness of COVID-19 vaccines in the elderly. MethodsThis study was conducted in Changning District of Shanghai， targeting people aged 60 years and above. Vaccination data between 21 December 2020 and 28 February 2022 was retrieved from the Shanghai Collective Immunization System. Information on confirmed cases of COVID-19 from March 2022 through May 2022 was collected from the National Notifiable Diseases Reporting System. Vaccine effectiveness was calculated using the screening method. ResultsAs of 28 February 2022， 69.89% of people aged ≥60 years had received ≥1-dose vaccine， 63.80% had received full primary vaccination and 31.91% had received a booster dose. Vaccination coverage declined over age， with the lowest coverage in the elderly aged ≥80 years. Moreover， COVID-19 vaccination provided the highest protection against severe/critical illness and death due to the Omicron variants in the elderly aged ≥60 years. Full primary vaccination showed 96.15%（95%CI：84.15‒99.06）of vaccine effectiveness and booster vaccination showed 100% of the effectiveness against severe/critical COVID-19 and death. ConclusionsFull primary and booster vaccination coverage in the elderly is low， especially in those aged 80 and above. Our study finds high protection against COVID-19 associated severe/critical illness and death from both full primary and booster vaccination of inactivated COVID-19 vaccines in the elderly aged ≥60 years.

Objective: To examine the trend of the burden on chronic obstructive pulmonary diseases (COPD) and epidemiologic transition on related risk factors among the Chinese population from 1990 to 2019. Methods: Based on the data from the Global Burden of Disease 2019 Study, we used the indicator numbers such as disability-adjusted life year (DALY), years of life lost (YLD), years lived with disability (YLL), and prevalence rate to describe the changes of COPD burden stratified by different sex and age groups from 1990 to 2019. We applied population attribution faction (PAF) to analyze the burden attributed to risk factors and epidemiological transition. Results: In 2019, the age-standard rate for DALY, YLD, and YLL and prevalence rate for COPD were 1 102.77/100 000 population,862.37/100 000 population, 240.40/100 000 population, and 2 404.41/100 000. Both age-standardized DALY and YLL rates for COPD in males were higher than in females, except for the YLD rate in females. COPD's top five risk factors were particulate matter pollution, smoking, occupational particulate matter, gases, and fumes, low temperature, and secondhand smoke. Smoking surpassed environmental particulate pollution in 1994 and became the first factor causing the disease burden of COPD. Since then, the order of risk factors has not changed. The PAF of environmental particulate pollutants increased by 1.78% annually, from 15.22% in 1990 to 25.37%, and the PAF of household air pollution from solid fuels decreased by 5.59% annually, from 40.30% in 1990 to 7.59%. Conclusions: From 1990 to 2019, the per person health loss caused by COPD in China showed an overall downward trend. The PAF of relevant risk factors has also changed, the importance of environmental factors is relatively declined, and the status of smoking and other related risk behaviors has become increasingly prominent. The prevention and control of COPD can focus on screening high-risk groups (≥40 years old, smoking, heavy air pollution, having occupational exposure), smoking cessation, and environmental treatment.
Female ; Male ; Humans ; Adult ; Cost of Illness ; Pulmonary Disease, Chronic Obstructive/epidemiology* ; Air Pollution/adverse effects* ; Particulate Matter ; China/epidemiology* ; Dust ; Gases