1.Problems and difficulties of early warning and response system for public health emergencies in China
Liqun LIU ; Qi ZHAO ; Genming ZHAO ; Qingwu JIANG
Chinese Journal of Schistosomiasis Control 1989;0(03):-
Objective To study current situation and existed problems in the public health emergency alert and response system so as to formulate more advices to consummate it and help to establish a more reasonable system adapting to our country. Methods A qualitative study was carried out among CDC working staff including two focus group discussions(FGD). Results Although government had put more emphasis on public health,increasing its devotion and strengthening the alert and response capability after SARS outbreak, some problems still existed, such as ① absence of correlative laws and rules; ② lack of government devotion; ③ insufficient utilization of surveillance information; ④ lack of the canonical response guidance. Conclusions With regard to the building up of the public health emergency alert and response system, the following proposals are put forward: increasing payout on public health; consummating the construction of disease surveillance network; affording more education and training to correlative staff engaged in the disease control to improve their abilities.
2.A cross-sectional study of urinary iodine and salt iodine content among schoolchildren and their families in Haimen City, Jiangsu Province
Peixin HUANG ; Feng JIANG ; Xin FENG ; Jianxiang LIU ; Meifang GU ; Qi ZHAO ; Qingwu JIANG
Chinese Journal of Endemiology 2014;33(6):654-656
Objective To understand the level of urinary iodine of schoolchildren and salt iodine content of their families in a primary school and to analysis influence between salt iodine content and urinary iodine level in Haimen City,Jiangsu Province.Methods A cross-sectional study was conducted in a primary school of Haimen City in 2012.With the method of stratified cluster sampling,all students aged 9 ~ 12 were extracted in grades 3-5,urine samples and salt samples of their family were collected.Urinary iodine and salt iodine were determined according to Method for Determination of Iodine in Urine by As3+-Ce4+ Catalytic Spectrophotometry (WS/T 107-2006) and Direct Titration of Universal Test method in Salt Industry (GB/T 13025.7-1999).Results Totally,452 students from grades 3-5,including 233 boys and 219 girls were selected by cluster-stratified sampling.The median of children's urinary iodine was 231.90 μg/L,while the median of boys and girls was 235.40 and 222.60 μg/L,respectively.The median of urinary iodine of 9,10,11 and 12 year old students was 253.65,195.70,236.40 and 241.70 μg/L,respectively.The proportion of less than 100 μg/L and ≥300 μg/L was 7.7% (35/452) and 27.7% (125/452),respectively.There were no significant differences between different gender and age students.Among the 452 salt samples collected the median of salt iodine was 27.50 mg/kg.The coverage rate of iodized salt,the qualified rate of iodized salt and the intake rate of qualified iodized salt were 98.9% (447/452),95.1% (425/447) and 94.0% (425/452),respectively.After consumptionn of non-iodized salt (< 5 mg/kg),unqualified iodized salt(5 ~ < 20 mg/kg or > 50 mg/kg) or qualified iodized salt [(35 ± 15)mg/kg],the median of urinary iodine of children was 177.30,211.95 and 232.90 μg/L,respectively.Correlation analysis showed that there was no relationship between iodine content of salt and urinary iodine level of schoolchildren (r =0.085,P > 0.05).Conclusions Current nutritional level of schoolchildren in Haimen City is higher than the appropriate amount.Household salt iodine content of edible salt does not affect urinary iodine level of the children significantly.
3.Value of Serum ProGRP,NSE and CEA Detection in Diagnosis of Small Cell Lung Cancer
Shukai SUN ; Qingwu TIAN ; Ruhua LIU ; Jingli SHEN ; Yue ZHAI ; Muxu ZHAI
Journal of Modern Laboratory Medicine 2016;(1):77-79
Objective To investigate the diagnostic value of combined detection of serum gastrin-releasing peptide precursor (ProGRP),neuron specific enolization enzyme(NSE)and carcinoembryonicantigen(CEA)in small cell lung cancer(SCLC). Methods 471 patients with lung tumor from department of respiratory medicine and thoracic surgery and 162 healthy people from medical examination center were studied.Serum levels of ProGRP,NSE and CEA were detected by using electrochemi-cal luminescence method.ROC curves were drawn and the area under the curve (AUC)was calculated.Results The levels of ProGRP and NSE were significantly higher in patients with SCLC than those in NSCLC,lung benign disease group and normal control group (P <0.01).The levels of CEA were significantly higher in SCLC than those in patients with lung be-nign disease group and normal control group (P <0.05).The AUC of ProGRP,NSE and CEA in the diagnosis of SCLC were 0.933,0.777 and 0.554,respectively.The sensitivity of ProGRP,NSE and CEA in the diagnosis of SCLC were 82.6%,60.4%,41.6% and the specificity were 95.2%,83.3% and 71.7% respectively.The sensitivity of combined detec-tion of ProGRP,NSE and CEA was 91.3% and the specificity was 65.3%.Conclusion The serum ProGRP detection has a higher diagnostic value for SCLC.The combined detection of ProGRP,NSE and CEA is useful in the early diagnosis of SCLC.
4.Cognizance of interpositional omentum and clinical significance
Xinjun WU ; Qingwu WU ; Yan LI ; Junyan YUE ; Yanxin WANG ; Guoze LIU ; Changhong DUAN ; Zhengqiang YAN
International Journal of Surgery 2012;39(5):317-320,封3
Objective To describe the interpositional omentum and demonstrate its clinical significance.MethodsCT and clinical data of the cases whose suprahepatic gaps widen were reviewed and the contrast of CT was adjusted to observe further.ResultsIn 1 916 cases with upper abdominal CT data,suprahepatic gap was widen in all 152 cases,and 119 cases showed fat density(6.21% ).There were 3 cases of trauma and 3 cases of acute abdomen in the 119 cases CT in the 119 cases displayed free gas under diaphragma,but displayed fat density after contrast adjusted.There were 11 cases undergoing operations,1 for sigmoid rupture 4 liver cirrhosis and portal hypertension,3 gastric cancer,and 1 acute cholecystitis,1 bile duct carcinoma and Ⅰ case congenital cystic dilatation of common bile duct.The other 108 cases did not undergo surgical operation.ConclusionsInterpositional omentum is a clinical phenomenon that the omentum was shift in suprahepatic gap covering the liver surface.It is not rarely,the incidence rate being 6.21% ( 119/1 916) in our study.The occurrence mechanism may be similar to that of Chilaiditi syndrome.It is difficult to differentiate interpositional omentum from free gas under diaphragms on CT plain scan picture,but it is easy after contrast adjusted of CT.Free gas under diaphragma should not be identify incorrecdied and patients should not undergo unnecessary surgical procedure.
5.Clinical characteristics and etiological analysis of early-onset and late-onset neonatal sepsis
Yueyao ZENG ; Tianqun FAN ; Ling LU ; Chunhua HAN ; Qingwu TIAN ; Hong JIANG ; Dongyun LIU
Chinese Journal of Clinical Infectious Diseases 2021;14(5):351-357
Objective:To analyze the clinical characteristics, etiology and outcome of early-onset neonatal sepsis (EONS) and late-onset neonatal sepsis (LONS).Methods:The clinical data of 265 neonates with NS admitted in the neonatal ward of the the Affiliated Hospital of Qingdao University from January 2014 to September 2020 were enrolled, including 76 cases of EONS and 189 cases of LONS. The general information, clinical manifestation, laboratory findings, pathogen distribution, treatment and outcome of the two groups were analyzed with SPSS25.0 statistical software.Results:The rates of meconium-stained amniotic fluid, prenatal maternal fever, abnormal white blood cell (WBC) count and neutrophil count in EONS group were significantly higher than those in LONS group ( P<0.05 or <0.01). However, the rates of indwelling central venous catheters, mechanical ventilation, fever, abdominal distension, abnormal platelet count and serum prealbumin level in LONS group were significantly higher than those in EONS group ( P<0.05 or <0.01). Staphylococcus epidermidis(135/265)and Staphylococcus aureus (22/265) were the most common gram-positive bacteria and Escherichia coli (13/265) was the most common gram-negative bacteria in NS. The proportion of gram-positive bacteria was the highest in both EONS group (85.5%) and LONS group (84.7%), which was mainly Staphylococcus epidermidis of coagulase negative staphylococci. The proportion of Listeria monocytogenes and Streptococcus infections in EONS group was significantly higher than that in LONS group ( P<0.05 or <0.01). The proportion of Staphylococcus aureus infection in LONS group was significantly higher than that in EONS group ( P<0.01). There was no significant difference in case fatality rate between EONS group and LONS group (6.6% vs 2.6%, P>0.05). Conclusions:Perinatal amniotic fluid pollution and prenatal maternal fever are risk factors for the occurrence of EONS, while indwelling central venous catheter and mechanical ventilation are risk factors for the occurrence of LONS. Abnormal platelet count and abnormal serum prealbumin are more common in the LONS group. The bacteria detected in EONS and LONS are mainly Staphylococcus epidermidis. Clinical diagnosis and treatment of EONS and LONS should be managed differently.
6.Effect of Sanjie Quban recipe on keloid model of BALB/C nude mice and influence on transforming growth factor-β1
Chuhan HUANG ; Dingquan YANG ; Shiyi ZHONG ; Ruiying WU ; Zhishan YANG ; Huijuan FANG ; Qingwu LIU
Chinese Journal of Comparative Medicine 2024;34(3):51-56
Objective This study aimed to investigate the therapeutic efficacy of Sanjie Quban recipe in a keloid nude mice model and its impact on transforming growth factor-β 1(TGF-β1).Methods Keloid tissue after surgical resection was subcutaneously transplanted into the backs of healthy SPF BALB/C female nude mice,aged 6~8 weeks,and a keloid nude mice model was thus established.The mice were randomly divided into three groups,the Sanjie Quban recipe group,the Asiaticoside tablet group and the control gnup,with five in each group.They were respectively treated with Sanjie Quban recipe,Asiaticoside tablets,or sterile pure water.After 28 days of continuous gavage,the keloid tissue was exfoliated and weighed,and HE staining,Masson staining,and immunohistochemical staining for TGF-β1 were conducted.Differences in keloid weight between the three groups before and after treatment were compared,as were the differences in collagen fiber,fibroblast numbers,and TGF-β1 expression between the three groups after treatment.Results The difference in keloid weight before and after treatment in the Asiaticoside tablet group was greater than that of the control group,and the weight difference before and after treatment keloid treatment was the largest in the Sanjie Quban recipe group(P<0.01).Compared with the control group,collagen fibers in the Sanjie Quban recipe group were looser and less numerous,and fibroblasts were decreased in number.The expression of TGF-β1 in the Sanjie Quban recipe group was decreased compared with that of the control group(P<0.01).Conclusions Sanjie Quban recipe has certain therapeutic effects on keloids.The mechanism may involve reducing the expression of TGF-βl in keloid tissue and thereby reducing the proliferation of fibroblasts and the synthesis of extracellular matrix.This study provides experimental and theoretical bases for the clinical treatment of keloids with Chinese medicine.
7.Analysis of NF2 gene mutations in intraspinal Schwannomas.
Shuyi LIU ; Shi CHEN ; Kaichuang ZHANG ; Jian LIN ; Qingwu YANG ; Yongliang ZHANG ; Shuiyuan LIU ; Shengze LIU
Chinese Journal of Medical Genetics 2017;34(5):637-641
OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.
METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.
CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.
Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics
8.Effect of comprehensive schistosomiasis control strategy with focus on cattle and sheep removal in Junshan District,Yueyang City
Wenbin LI ; Ya YANG ; Xiang PAN ; Jianbing LI ; Huixiang LIU ; Shigui LI ; Zhong HE ; Bin CAI ; Linhan LI ; Wanting CHENG ; Yu YANG ; Jie ZHOU ; Shengming LI ; Guanghui REN ; Zhihong LUO ; Yibiao ZHOU ; Qingwu JIANG
Chinese Journal of Schistosomiasis Control 2017;29(4):402-405,411
s] Objective To evaluate the effect of comprehensive schistosomiasis control measures with focus on total removal of cattle and sheep in Junshan District,Yueyang City. Methods The retrospective review and field survey were implemented in the pilot villages in Junshan District. The data of Schistosoma japonicum infection status of human,cattle,sheep and Oncome-lania hupensis snails,and density of snails were gathered and modeled in the period of 2006 to 2016. Results The prevalence of schistosome infection in residents in the pilot villages decreased from 3.44% in 2006 to 0.59% in 2012(F = 14.501,P =0.013). After removal of all the cattle and sheep in 2013,the prevalence of schistosome infection in the residents decreased to zero in 2016(F=14.148,P=0.033). The density of living snails decreased from 0.8833/0.1 m2 in 2006 to 0.3088/0.1 m2 in 2012(F=76.250,P=0.005). Conclusion The comprehensive schistosomiasis control strategy with focus on cattle and sheep removal is remarkably effective.
9.Clinical medical education in Ethiopia and its enlightenment
Rui XU ; Xiaoyan CHEN ; Chunmei DUAN ; Shu LIU ; Qingwu YANG ; Yang BAI
Chinese Journal of Medical Education Research 2020;19(11):1267-1270
In the field of medical education, Ethiopia has made a great progress in recent years. After systematical inquiry of Ethiopia's clinical medical education, this paper elaborates the mode of undergraduate teaching in Ethiopia from aspects of curriculum design, emphasis of contents, teaching methods and assessment methods, and also introduces the development and continuing education of Ethiopian medical students after graduation. Moreover, the "Innovative Track" clinical medical education reform proposed by Ethiopia recently is introduced as well. Therefore, characteristics and advantages of clinical teaching in Ethiopia indicate that in the process of deepening the medical education reform in China, we should learn from different countries. In this way, the development of medical education in China can be promoted better and faster.
10.Non-invasive imaging of pathological scars using a portable handheld two-photon microscope
Yang HAN ; Yuxuan SUN ; Feili YANG ; Qingwu LIU ; Wenmin FEI ; Wenzhuo QIU ; Junjie WANG ; Linshuang LI ; Xuejun ZHANG ; Aimin WANG ; Yong CUI
Chinese Medical Journal 2024;137(3):329-337
Background::Pathological scars are a disorder that can lead to various cosmetic, psychological, and functional problems, and no effective assessment methods are currently available. Assessment and treatment of pathological scars are based on cutaneous manifestations. A two-photon microscope (TPM) with the potential for real-time non-invasive assessment may help determine the under-surface pathophysiological conditions in vivo. This study used a portable handheld TPM to image epidermal cells and dermal collagen structures in pathological scars and normal skin in vivo to evaluate the effectiveness of treatment in scar patients. Methods::Fifteen patients with pathological scars and three healthy controls were recruited. Imaging was performed using a portable handheld TPM. Five indexes were extracted from two dimensional (2D) and three dimensional (3D) perspectives, including collagen depth, dermo-epidermal junction (DEJ) contour ratio, thickness, orientation, and occupation (proportion of collagen fibers in the field of view) of collagen. Two depth-dependent indexes were computed through the 3D second harmonic generation image and three morphology-related indexes from the 2D images. We assessed index differences between scar and normal skin and changes before and after treatment.Results::Pathological scars and normal skin differed markedly regarding the epidermal morphological structure and the spectral characteristics of collagen fibers. Five indexes were employed to distinguish between normal skin and scar tissue. Statistically significant differences were found in average depth ( t = 9.917, P <0.001), thickness ( t = 4.037, P <0.001), occupation ( t= 2.169, P <0.050), orientation of collagen ( t = 3.669, P <0.001), and the DEJ contour ratio ( t = 5.105, P <0.001). Conclusions::Use of portable handheld TPM can distinguish collagen from skin tissues; thus, it is more suitable for scar imaging than reflectance confocal microscopy. Thus, a TPM may be an auxiliary tool for scar treatment selection and assessing treatment efficacy.