1.Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative
Qifang LIN ; Wanjin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2011;44(8):568-573
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.
2.Application research of Galectin-3 and Bcl-2 in colorectal tissues of patients with ulcerative colitis
Qifang ZHANG ; Xiaoyan LI ; Yuanyuan WANG ; Xirong LI ; Zhuolin CHEN ; Yi ZHENG ; Siming HE ; Yongchang CHEN ; Haixing JIANG
Chongqing Medicine 2015;(2):180-182,185
Objective To explore the expressions and significance of Galectin‐3 and Bcl‐2 in colorectal tissues of patients with ulcerative colitis(UC) .Methods Immunohistochemical SP method was applied to detected the expression of Galectin‐3 and Bcl‐2 in colorectal tissues of 60 patients in UC group and 20 healthy adults in the control group ,and analyzed the relationship of the expres‐sions between Galectin‐3 and Bcl‐2 .It was regarded as positive cell when obvious dark brown granules appeared in cytoplasm or cyteblast .Semi‐quantitative analysis was used basing on the staining intensity and the amount of the staining intensity and positive cells .Results Galectin‐3 and Bcl‐2 proteins expressed in cytoplasm .Galectin‐3 showed strong expression in normal colorectal epi‐thelium but weak in UC inflammatory tissues ,and it was associated with different lesion degrees under endoscopy .The expressions of Bcl‐2 were weak in normal colorectal epithelium ,and it enhanced significantly in UC inflammatory tissues ,especially in inflamma‐tory cells of laminae propria ,and it was not associated with different lesion degrees under endoscopy .The expression of Galectin‐3 and Bcl‐2 was not associated with the age ,sex of patients and the course of UC .Pearson correlation analysis showed that the posi‐tive expressions of Galectin‐3 and Bcl‐2 had no relevance .Conclusion Galectin‐3 and Bcl‐2 involved in the pathogenesis of UC . They may be able to used as markers of early diagnosis and prognosis in UC and may play the role in the pathogenesis of UC inde‐pendently .
3.The rheology properties of common hydrophilic gel excipients.
Yanlong HOU ; Heran LI ; Yanan GAO ; Yan WANG ; Qifang WANG ; Lu XU ; Zhenyun LIU ; Hongtao CHEN ; Sanming LI
Acta Pharmaceutica Sinica 2014;49(8):1181-7
To investigate theological properties of common hydrophilic gel excipients such as Carbopol based on viscosity, the viscosity was determined by rotation method and falling-ball method. Linear regression was made between ln(eta) and concentration, the slope of which was used to explore the relation between viscosity and concentration of different excipients. The viscosity flow active energy (E(eta)) was calculated according to Arrhenius equation and was used to investigate the relation between viscosity and temperature of different excipients. The results showed that viscosities measured by two methods were consistent. Concentration of guargum (GG) and hydroxypropylmethyl cellulose (HPMC) solution had a great influence on the viscosity, k > 5; while concentration of polyvinylpyrrolidone-K30 (PVP-K30) and polyethylene glycol 6000 (PEG6000) exerted a less effect on viscosity, k < 0.2; viscosity flow active energy of different excipients were close, which ranged from 30 to 40 kJ x mol(-1). Therefore, theological properties study could provide the basis for application of excipients and establish a foundation for the research of relation between excipients structure, property and function.
4.Expression of ER,HNF-1β and COX-2 in endometriosis-associated ovarian cancer and its clinical significance
Chongqing Medicine 2017;46(27):3801-3803,3807
Objective To investigate the expression difference of estrogen receptor(ER),hepatocyte nuclear factor 1β(HNF-1β) and epoxy-2(COX-2) in different types of endometriosis-associated ovarian cancer (EAOC).Methods Forty-four patients with EAOC treated in our hospital from July 2011 to April 2016 were selected,including 17 cases of endometrioid carcinoma,21 cases of clear cell carcinoma and 6 cases of ovarian serous carcinoma.The expression of ER,HNF-1β and COX-2 in different types of EAOC were detected by immunohistochemistry.The correlation among expression levels of ER,HNF-1β and COX-2 was investigated by adopting Spearman rank correlation analysis.Results The positive rate of ER in endometrioid carcinoma was 100.0%,which was significantly higher than 9.5% in the patients with clear cell carcinoma and 0% in the patients with ovarian serous carcinoma(x2=4.305,P<0.01),and the positive rate of HNF-1β in the patients with clear cell carcinoma and ovarian serous carcinoma were 85.7% and 100.0% respectively,which was significantly higher than 11.8% in the patients with endometrioid carcinoma(x2 =3.585,P<0.01),the positive rates of COX-2 in the patients with endometrioid carcinoma,clear cell carcinoma and ovarian serous carcinoma were 76.5%,81.0% and 83.3%,respectively,and the difference was not statistically significant (x2 =0.744,P =0.104).The correlation analysis showed that ER was negatively correlated with HNF-1β expression level(r=-0.428,P<0.01)and positively correlated with COX-2 expression level (r=0.204,P=0.013).Conclusion ER is mainly expressed in endometrioid carcinoma.HNF-1β is mainly expressed in clear cell carcinoma and ovarian serous carcinoma.The expression level of ER had a certain correlation to the expression of HNF-1β and COX-2,which may be closely related to EAOC progression.
5.Cerebellar Structural Abnormality in Autism Spectrum Disorder: A Magnetic Resonance Imaging Study
Qifang LU ; Jin CHEN ; Yanming WANG ; Li HUANG ; Zhoufan JIANG ; Benedictor Alexander NGUCHU ; Shishuo CHEN ; Bensheng QIU ; Xiaoxiao WANG
Psychiatry Investigation 2023;20(4):334-340
Objective:
This study uses structural magnetic resonance imaging to explore changes in the cerebellar lobules in patients with autism spectrum disorder (ASD) and further analyze the correlation between cerebellar structural changes and clinical symptoms of ASD.
Methods:
A total of 75 patients with ASD and 97 typically developing (TD) subjects from Autism Brain Imaging Data Exchange dataset were recruited. We adopted an advanced automatic cerebellar lobule segmentation technique called CEREbellum Segmentation to segment each cerebellar hemisphere into 12 lobules. Normalized cortical thickness of each lobule was recorded, and group differences in the cortical measures were evaluated. Correlation analysis was also performed between the normalized cortical thickness and the score of Autism Diagnostic Interview-Revised.
Results:
Results from analysis of variance showed that the normalized cortical thickness of the ASD group differed significantly from that of the TD group; specifically, the ASD group had lower normalized cortical thickness than the TD group. Post-hoc analysis revealed that the differences were more predominant in the left lobule VI, left lobule Crus I and left lobule X, and in the right lobule VI and right lobule Crus I. Lowered normalized cortical thickness in the left lobule Crus I in the ASD patients correlated positively with the abnormality of development evident at or before 36 months subscore.
Conclusion
These results suggest abnormal development of cerebellar lobule structures in ASD patients, and such abnormality might significantly influence the pathogenesis of ASD. These findings provide new insights into the neural mechanisms of ASD, which may be clinically relevant to ASD diagnosis.
6.Effects of basic fibroblast growth factor on pericytes in mice with traumatic brain injury
Chenhuai TENG ; Fangfang WU ; Man ZHANG ; Qifang HE ; Chengjie JIANG ; Daqing CHEN
Chinese Journal of Trauma 2018;34(1):61-67
Objective To investigate the effects of basic fibroblast growth factor (bFGF) on pericytes in the blood brain barrier at acute stage after traumatic brain injury (TBI) in mice.Methods A total of 90 mice with a C57BL/6 background were randomly divided into sham group,TBI group,and TBI + bFGF group,with 30 rats per group.The models of moderate TBl were established using the controlled cortical impactor.After 24 hours,the changes of nerve function were evaluated by Garcia neurological score.Each mouse received an intraperitoneal injection of Evans blue dye for measuring the permeability of blood brain barrier.Western blot was used to test the related indices of pericytes after the cerebral cortex was quickly dissected:platelet-derived growth factor receptor beta (PDGFR-β),aminopeptidase N (CD13),desmin,neurogliocyte 2 (NG2),and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).Paraffin sections were prepared for HE staining and morphological changes were observed.Immunofluorescence assay was used to test the related indices of pericytes:PDGFR-β,CD13,and cell surface glycoprotein MUC18 (CD146).Results Garcia neurological score revealed that the score in TBI group was significantly decreased compared with that in sham group (P < 0.01),but the score of TBI + bFGF group was significantly increased compared with that of TBI group (P < 0.05).Permeability of blood brain barrier in TBI group was significantly increased compared with that in sham group (P <0.01),but in TBI + bFGF group this parameter significantly reduced compared with that in TBI group (P < 0.01).Western blot analysis revealed that the expressions of PDGFR-β,CD13,desmin,NG2 proteins in TBI group were significantly decreased compared with those in sham group (P <0.05),while the expressions of PDGFR-β,CD13,desmin,NG2 proteins in TBI + bFGF group were significantly increased compared with those in TBI group (P < 0.05).HE staining revealed injury of brain parenchyma in TBI group was the severest compared with both sham group and TBI + bFGF group.Immunofluorescence staining results revealed that the proteins expressions of PDGFR-β,CD13,and CD146 in TBI group were significantly decreased compared with those in sham group (all P <0.01),and those in TBI + bFGF group were significantly increased compared with those in TBI group (all P < 0.05).Conclusions bFGF can prevent pericyte death via protecting its proteins to conserve blood-brain barrier,bFGF can also significantly ameliorate the injury of brain parenchyma.
7.Spectral CT imaging in the evaluation of composition of kidney stones
Xiaohu LI ; Yongqiang YU ; Wanqin WANG ; Bin LIU ; Yifei ZHANG ; Shuai ZHANG ; Ken CHEN ; Shiyu WANG ; Yuhui WAN ; Xingwang WU ; Yong ZHOU ; Le WANG ; Qifang YANG ; Jie WANG
Chinese Journal of Radiology 2011;45(12):1216-1219
ObjectiveTo evaluate the feasibility of determining the chemical composition of kidney stones using gemstone spectral imaging ( GSI ).Methods One hundred and sixty eight extracted human kidney stones immersed in a 10 cm deep water tank underwent CT (Discovery CT750 HD) scans with GSI mode and conventional polychromatic imaging ( CPI,120 kVp) mode.All GSI data were transferred to Workstation AW 4.4 to acquire monochromatic images of 50 keY,effective atomic number (Zeff) mapping images,water (calcium)-based images and calcium (Water)-based images with GSI Viewer.CT numbers of stones were measured and compared at 50 keV monochromatic images and 120 kVp polychromatic images,the mean Zeff,calcium density and water density were measured at Zeff mapping images,Calcium (Water) -based images and Water (Calcium)-based images,respectively.The mean Zeff,spectral HU curve slope and calcium water ratio (CWR) were compared with ANOVA and Wilcoxon test.The composition of kidney stones was determined by infrared spectrometer after CT examination.According to the result of stone composition determined by infrared spectroscopy,108 pure kidney stones were divided into five groups:Uric acid stones ( UA,n = 13 ),struvite stones ( STR,n = 24),cystine stones ( CYS,n = 14),calcium phosphate stones ( CaP,n = 18),and calcium oxalate stones ( COX,n = 39).ResultsThe mean Zeff,CWR,the mean CT numbers at 50 keV images,120 kVp images and spectral HU curve slope of each group were listed as the following:UA [ 7.4 ± 0.4,0.0085 ± 0.0021,( 503 ± 168 ) HU,(495 ± 106 ) HU and - 0.77 ] ; STR [ 11.8 ± 0.9,0.1743 ± 0.0677,( 1056 ± 290 ) HU,( 799 ± 165 ) HU and 18.72 ] ; CYS [ 11.2 ± 0.6,0.1253 ± 0.0297,( 740 ± 172 ) HU,( 565 ± 129 ) HU and 12.79 ] ; CaP [ 16.0 ± 0.4,0.6781 ± 0.0952,( 2567 ±178 ) HU,( 1602 ± 200 ) HU and 37.14 ] ; COX [ 15.4 ± 0.4,0.5683 ± 0.0759,( 2267 ± 385 ) HU,( 1489 ±284) HU and 36.36 ],there were significant differences among groups ( P < 0.01 ).The differences in the mean Zeff,CRW,spectral HU curve slope were statistically significant among the five groups ( P < 0.05 ).Conclusion Spectral CT imaging provides a new method to characterize the kidney stones with the information orovided by mean Zeff,CRW and the CT numbers at 50 keV.
8.Construction of a risk prediction model for enteral nutrition feeding intolerance in patients with abdominal trauma
Ping CAO ; Qian CHEN ; Xijuan LI ; Qifang XU
Chinese Journal of Modern Nursing 2024;30(5):656-660
Objective:To explore the influencing factors of enteral nutrition feeding intolerance (FI) in patients with abdominal trauma and construct a risk prediction model.Methods:This was a retrospective study. General and clinical data such as Acute Physiology and Chronic Health Evaluation (APACHEⅡ), Glasgow Coma Scale (GCS), Injury Severity Score (ISS), and Acute Gastrointestinal Injury (AGI) of patients with abdominal trauma and enteral nutrition admitted to Department of Emergency Surgery of the First Affiliated Hospital of Zhengzhou University from January 2021 to January 2023 were collected by means of medical record inquiry. Patients were divided into FI group and non-FI group according to whether FI occurred within three days after receiving enteral nutrition. Multivariate Logistic regression analysis was used to explore the influencing factors of FI in patients with abdominal injury and to construct the related risk prediction model. The diagnostic value of the prediction model was evaluated by the area under the receiver operating characteristic curve.Results:A total of 101 research objects were included, including 30 patients with enteral nutrition FI and 71 patients without enteral nutrition FI. The multivariate Logistic regression results analysis showed that injury severity score, acute gastrointestinal injury grading, and hypoalbuminemia were the influencing factors of enteral nutrition FI in patients with abdominal injury ( P<0.05). A risk prediction model for enteral nutrition FI in patients with abdominal injury was constructed based on the above factors. The area under the receiver operating characteristic curve (AUC) of the predictive model was 0.856, with a sensitivity of 0.833, a specificity of 0.732, a Jordan index of 0.565, and an optimal critical value of 0.265. Conclusions:The constructed risk prediction model for enteral nutrition FI in patients with abdominal injury has good predictive performance, which can provide a reference for medical staff to predict the risk of enteral nutrition FI in patients with abdominal injury.
9.Quantitative study of abdominal hemorrhage in abdominal trauma based on computed tomography images
Jian CHEN ; Chenhuai TENG ; Qifang HE ; Hao WEN ; Weiyang MENG ; Can JIN ; Daqing CHEN
Chinese Journal of Trauma 2017;33(12):1109-1112
Objective To verify the feasibility and accuracy of the quantitative evaluation of the volume of internal abdominal hemorrhage based on CT images.Methods The clinical data of 76 patients diagnosed as abdominal hemorrhage or hemoperitoneum and performed with emergency surgery in the Second Affiliated Hospital to Wenzhou Medical University from January 2009 to September 2016 were retrospectively analyzed by case-control study.The Noboru Oriuchi's formula was used to calculate the volume of abdominal hemorrhage based on CT images,and the results were compared and adjusted with the volume of actual abdominal hemorrhage recorded during the operation.SPSS 21.0 was used to statistically analyze the data.The linear regression was analyzed on the results measured by the two methods.Results The volume of abdominal hemorrhage measured by the CT calculation method ranged from 10 to 4 335 ml,while the corresponding volume measured by operational calculation method ranged from 200 ml to 4 490 ml.The absolute difference in the volume measured by these two methods ranged from 4.8 ml to 500 ml.The ratio of the absolute difference to the volume of abdominal hemorrhage by operational calculation method ranged from 0.2% to 95.0%,the median of which was 4.5% (2.8%,8.9%).When the exact volume of abdominal hemorrhage was < 500 ml,the absolute difference in the exact volume ranged from 30.0% to 95.0%,the median of which was 69.1% (51.2%,78.6%).When the volume was less than 500 ml,the ratio ranged from 0.2%-13.6%,the median of which was 4.2% (2.7%,6.4%).Analysis of the numbers of the two measuring methods with linear correlation method after eliminating the cases in which the bleeding volume was less than 500 ml showed that two methods presented a linear correlation (r =0.971,P < 0.05).Conclusion After the conventional abdominal CT scanning,the Noboru Oriuchi's formula can be used to accurately calculate the volume of abdominal hemorrhage in patients with volume of abdominal hemorrhage more than 500 ml.
10.Etiological characterization of invasive non-typhoid Salmonella strains in Guangdong Province from 2018 to 2022
Min ZOU ; Dongmei HE ; Jing XU ; Qi CHENG ; Fangzhu OUYANG ; Leyan CHEN ; Qifang CHEN ; Changwen KE ; Bixia KE
Chinese Journal of Epidemiology 2024;45(4):520-528
Objective:To understand the serotype distribution, drug resistance and molecular characterization of invasive non-typhoid Salmonella (iNTS) in Guangdong Province from 2018 to 2022 and provide scientific evidence for the prevention and treatment of blood flow infection caused by Salmonella. Methods:Serological identification, antimicrobial susceptibility testing, multilocus sequence typing (MLST), and whole genome sequencing were performed on Salmonella isolated from blood and stool samples in Guangdong from 2018 to 2022. Simultaneously, annotated the sequencing results for drug resistance genes and virulence factors by a microbial gene annotation system. Results:The 136 iNTS strains were divided into 25 serotypes, and Salmonella enteritidis accounted for 38.24% (52/136). The OR of other iNTS serotypes were calculated with Salmonella typhimurium as the control. The OR values of Oreninburg, Rysson, and Pomona serotypes were the highest, which were 423.50, 352.92, and 211.75, respectively. The drug resistance rate of iNTS was 0.74%-66.91%, which was lower than that of non-iNTS (3.90%-77.21%). The main iNTS of drug resistance were ampicillin and tetracycline, with resistance rates of 66.91% (91/136) and 50.00% (68/136), respectively, while the resistance rates to ciprofloxacin (5.88%,8/136), ceftazidime (5.88%,8/136), gentamicin (5.13%,7/136) and cefoxitin (0.74%, 1/136) were relatively low. iNTS carried a variety of drug-resistance genes and virulence factors, but no standard virulence factor distribution has been found. MLST cluster analysis showed that iNTS was divided into 26 sequence types, and ST11 accounted for 38.24% (52/136). Conclusions:The iNTS strains in Guangdong were dominated by Salmonella enteritidis, of which three serotypes, Oreninburg, Rison, and Pomona, may be associated with a higher risk of invasive infection during 2018 to 2022 . iNTS was sensitive to clinical first-line therapeutic drugs (cephalosporins and fluoroquinolones), with highly diverse sequences and clear phylogenetic branches. ST11 was the local dominant clone group.