Objective To evaluate the efficacy of different doses of dexmedetomidine mixed with ropivacaine for brachial plexus block.Methods One hundred and twenty ASA physical status Ⅰ or Ⅱ patients of both sexes,aged 20-60 yr,weighing 40-70 kg,scheduled for upper extremity surgery under brachial plexus block,were randomly divided into 6 groups (n =20 each):ropivacaine group (group R) and different doses of dexmedetomidine groups (groups RD1-5).Brachial plexus block was performed using the interscalene approach.In group R,interscalene brachial plexus block was performed using 0.5 ％ ropivacaine 25 ml (single injection).In groups RD1.5,interscalene brachial plexus block was induced with a mixture (25 ml) of dexmedetomidine 0.25,0.50,0.75,1.00,1.25μg/kg and 0.5 ％ ropivacaine,respectively.The onset time and duration of sensory and motor block were recorded.The adverse effects such as adverse cardiovascular events,excessive sedation,and pneumothorax were also recorded.Results Compared with group R,the onset time was significantly shortened,and the duration of block was prolonged (P ＜ 0.05).Compared with groups RD1 and RD2,the onset time was significantly shortened,and the duration of block was prolonged in groups RD3 5 (P ＜ 0.05).There was no significant difference in the parameters mentioned above between groups RD1 and RD2 or among groups RD3,RD4 and RD5 (P ＞ 0.05).Some patients developed bradycardia,hypotension or excessive sedation in groups RD4 and RD5,while no adverse effects were observed in the other groups.Conclusion Dexmedetomidine 0.75 μg/kg mixed with 0.5 ％ ropivacaine 25 ml can be safely and effectively used for brachial plexus block in patients.

Acupuncture Points ; Acupuncture Therapy ; Adolescent ; Adult ; Aged ; Facial Paralysis ; therapy ; Female ; Humans ; Male ; Middle Aged ; Young Adult

AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.

Aim To observe the influence of hydrogen sulfide on L-arginine/nitric oxide synthase(NOS)/NO pathway,explore the interaction between H_2S and NO as cardiovascular regulatory gasotransmitters.Methods Aortic thin slices in vitro were administrated with NaHS(10~(-7) mol?L~(-1)～10~(-4) mol?L~(-1)),a donor of H_2S,and incubated for 4 hours,or 50 ?mol?L~(-1) NaHS and incubated for 2 h,4 h and 6 h,respectively.The nitrite production Was measured with greiss assay;NOS activity and L-arginine transportation,with isotope tracer method;the eNOS and CAT1-A gene expression,with RT-PCR.Results After being given with NaHS(50 ?mol?L~(-1)) one time,and incubating for 2 h,the nitrite production decreased by 62%,NOS activity reduced by 48% and L-arginine transport decreased by 50%.After incubation for 6 h,the nitrite production further was inhibited by 19%(P0.05).NaHS(10~(-7) mol?L~(-1)～10~(-4) mol?L~(-1)) inhibited the L-arginine/NOS/NO pathway in a dose-dependent manner,and IC_(50) was 0.499,3.198 and 3.927 ?mol?L~(-1)(P

Objective To examine whether the two vascular paracrine/autocrine factors, angiotensin Ⅱ (Ang Ⅱ) and endothelin, participate in the pathogenesis of arterial calcification. Methods Nicotine and vitamin D3 treated rats were studied. Vascular calcification was confirmed by using Von Kossa staining, measurement of calcium content,45Ca2+ uptake assay and alkaline phosphatase (ALP) activity. The plasma and vascular Ang Ⅱ and endothelin levels were measured by using radioimmunoassay. Angiotensinogen and endothelin mRNA levels were determined by RTPCR. Results The arterial calcium content, 45Ca2+ uptake and ALP activity were increased in calcification groups compared with control ( P ＜ 0.01 ). Administration of the angiotensin receptor antagonist losartan, the endothelin receptor antagonist bosentan, and the angiotensin-converting enzyme inhibitor captopril reduced significantly the arterial calcium content, 45Ca2+ uptake and ALP activity. In addition, the plasma and aortic Ang Ⅱ and endothelin contents, and vascular angiotensinogen and endothelin mRNA expression were significantly up-regulated ( P ＜0.05).Conclusions These findings suggest that functional renin-angiotensin system and endothelin pathway are involved in vascular calcification, and that activation of these systems could potentiate pathogenesis of arterial calcification. ( J Geriatr Cardiol 2004;1(2) :108-113. )

Objective To provide structure and function applied anatomical of nasal sub-units for plastic and reconstruction. Methods Twelve cases fresh nose from adult head specimen,to dissect the skin,muscle fascia system, cartilage and bone,to observe and digiital measure nerve, blood vessel and ligament between cartilage. Results The thinnest skin in the point of bone and cartilage junction,the thickest parts in the nasion and the supratip breakpoint.Nose contours include of the skin,cartilage,bones and vascular muscle fascia system;Nasal subunit can be divided into nasion area,nasal dorsum area, nasal tip area,nasal ala area and nasal columella area;Nasal valve was a important anatomic part of bremh.The nasal lateral osteotomy of maxilla can change 2 mm height and width of the nasal bone;Lower lateral cartilage and upper nasal cartilage connection can be separated 6~8 mm. Curvature changes in the crura intermedium of alar cartilage Can raise nasal tip 2 mm. Extent of septal cartilage was 15 mm×20 mm,thickness was 1 mm.The mainly blood supply come from facial artery and ophthalmic artery. Vein accompanying with the same name.Lymphatic flow in the area of superficial muscle fascia. Concision Nasal bone lateral osteotomy can raise up bridge of the nose.To lengthen and highten nasal tip based on the complete strip technique of lower lateral cartilage and upper lateral,and to change angel of medial crus and middle crus of lower lateral cartilage by suture rotation.Nasal skin is rich in artery and vein,so much as four networks.Because the syndrome of nasal contraction deformation occurred more and more recently we must to avoid the vascular network injury when operation, and the anatomical level should be give more noted.

Objective To understand the status of the radiation therapy in sichuan province, analysis the development level of radiotherapy in the past five years in sichuan province,provide reference for the rational allocation of radiotherapy resources in the province, promote the healthy development of radiotherapy. Methods With reference to the surveys carried out by other provinces and the survey of sichuan province in 2009,to determine the survey schemes,survey projects. The survey covers all medical units of radiation therapy in the province, adopt the way of combination of questionnaire and on?the?spot visiting. Results There is a big progress in basic condition, treatment equipment, auxiliary equipment, verification equipment,personnel and application of new technologies. Compared with 2009 survey,multiple projects achieve a 50% or even more than 100% growth. Conclusions The rapid development of radiation oncology in sichuan province will ultimately benefit a large number of tumor patients in sichuan province. Patients will be treated with better environment,treatment technology and quality. At the same time,higher requirement of quality control for the entire province is put forward to us.

AIM: To observe the changes of cystathionine-lyase/hydrogen sulfide(CSE/H_2S) in vivo in vascular calcification and to explore the role of CSE/H_2S in vascular calcification.METHODS: Vascular calcification model in rats was induced by administration of vitamin D_3 plus nicotine.The extent of calcification was estimated by assaying calcium content.[~(45)Ca~(2+)] deposition and alkaline phosphatase(ALP) activity were detected.CSE mRNA amount was determined by using competitive quantitative RT-PCR.The content of H_2S and activity of CSE in the plasma and cardiovascular tissues were also determined with biochemical methods.RESULTS: Calcium content in myocardium increased by 3.8 folds in a calcification model.Compared to control,calcium content,[~(45)Ca~(2+)] accumulation and ALP activity in calcified arteries increased by 6.8,1.4,and 1.9 folds,respectively(P

AIM: In this study, we aimed to explore the alteration and pathophysiological significance of the L-arginine (L-Arg)/NOS/NO pathway in the adventitia of rats with sepsis. METHODS: Sepsis was induced by cecal ligation and puncture (CLP). Rat cardiac function was determined. NO generation, NOS activity and L-Arg transport were measured. The iNOS mRNA levels was determined by using RT-PCR. RESULTS: Cecal ligation and puncture induced severe sepsis with severe low glucose, high lacticemia and cardiac function inhibition. The iNOS activity was increased by 2.8-fold compared with controls (P

Objective To evaluate the diagnostic value of detection of IgM antibodies to EV71-infection patients,and compared characterisation of RT-PCR,IgM capture ELISA and neutralization test.Methods Virus RNA,neutralization titer and IgM antibody in 115 EV71-infection patients were detected by EV71 real-time RT-PCR kit( EV71-PCR kit),neutralization test,and EV71 IgM-capture ELISA kit (EV71-IgM kit),respectively.Results Using EV71-IgM kit,the detection rate was 80.9％ (93/115,95％ CI:72.5-87.6) among the 115 EV71-infection patients,and was 2.6％ among the 228 healthy children.Simultaneously,sera collected after 1-2 day of disease onset showed an IgM positivity of 70.4％ (38/ 54).The positive rate of EV71-PCR among these patients was 82.6％ (95/115,95％ CI:74.4-89.0),so there was no statistically significant differences between it and EV71-IgM kit.In addition,the detection rate in EV71-infection patients could increase to 92.2％ by combined detection of EV71-PCR and EV71-IgM kit.Conclusion EV71-IgM kit was a rapid and valuable way for the early diagnosis of EV71 infection,and could significantly improve detection rate for EV71 infection by combining with EV71-PCR kit.