Objective To measure the extent of malrotation of femur fractures with CT scan after fixation with interlocking intramedullary nailing , and to discuss the methods which can help to correct the malrotation of femur fracture during the operation. MethodWith CT scan, the anteversion of femur fracture after the close reduction and fixation with interlocking intramedullary nailing in 56 cases was measured, and the difference of anteversion between the fracture side and the contralateral side was evaluated. The increase of anteversion represented internal rotation of the distal fragment, whereas the decrease of anteversion meaned external rotation. According to AO classification system, the type A of infratrochanteric fractures happened in 9 cases, type A of femoral shaft fractures happened in 12 cases, type B in 15 cases,type C in 7 cases,and 13 cases of femoral supercondyle fractures were type A. ResultThe results of measurement showed that the femoral anteversion after fixation with interlocking intramedullary nailing was changed in all patients. The anteversion of the femoral shaft fracture ranged from 13.35?to 47.21?. The aneversion of infrotrochanteric fractures ranged from -7.12?to 36.35?, and the supercondyle fracture of femur from -11.10?to 39.22?. For the extent of malrotation of distal femoral fracture, the internal rotation was more obvious than the external rotation. The number of Internal rotation cases accounted for 60.71%, and the external cases accounted for 39.29%. The maximum internal malrotation happened in femoral shaft fracture, from 1.37?to 29.82?with average malrotation 12.34?. and the minimum internal malrotation happened in infratrochanteri fracture, from 0.81?to 23.21?,with the average malrotation 8.32?. The medium internal malrotation was femoral supercondyle fracture, from 1.72?to 27.11? with the average malrotation 8.38?. The maximum external malrotation happened in femoral shaft fracture, from 1.11?to 21.12?with the average of them 9.33?. The minimum external malrotation happened in infratrochanteri fracture, from 1.31?to 16.23?with the average 7.71?. The medium external malrotation was seen in femoral supercondyle fracture, from 0.97?to 17.96?with average 8.22?. For these three parts of femoral fracture, the partnership T test was done between the fracture side and the contralateral side, the results showed that there were significant differences among of them,P

[Objective] To compose carbonated hydroxyapatite cement with chemica l materials,and by adding the pore agent to develop a new bone substitute,which can be solidified in situ to form porous carbonated hydroxyapatite.[Method](1)A new type of carbonated hydroxyapatite cement(CHC)was prepared.The powder of cement was composed of calcium carbonate,tricalcium phosphate and calcium phosphate dibasic.The liquids were prepared by 0.2mol/L sodium phosphate buffer,solide phase to liquid phase was 1g to 0.4 ml;(2)To prepare an in situ setting porous carbonated hydroxyapatite cement,add the pore agent into the powder of cement,pore generate CO2 during situ setting of cement;(3)The chemcial composition,chemcial constitution mechanical property,setting time,interval porosity of the PCHA were tested.and then the physio-chemical character,manipulatity,histocompatibility were evaluated.[Result]Addition of pore agent could succeed to prepare a new bone substitute which could set in situ and transform into porous carbonated hydroxyapatite.The setting time was 13~15 minutes which was suitable to clinical application.The pore size and porosity character could be controlled by adjustment of the component.The checking results demonstrated that the self-setting composition of this cement was carbonated hydroxyapatite which was similar with the mineral phase of natural cancellous bone,the carbonic acid radical was 5.6% in the solidify production.Contain of the porosity was 36% with interconnect pore,the compressive strength was 5.6?2.2 MPa which was equal to strength of cancellous bone,and the cytotoxicity tests showed an exellent biocompatibility.[Conclusion]The porous carbonated hydroxyapatite cement is a good bone substitute which seems to be the cancellous bone with good porosities,exellent biocompatibility.

Objective:The protein of missing in metastasis (MIM), a novel discovered actin-binding scaffold protein, is involved in actin cytoskeleton rearrangements, signal transduction and transcriptional activation, and has close association with tumor growth, invasion, and metastasis. Recently, much focus has been placed on the role of MIM performed in tumor progression. In recent years, more and more attention is focused on its action mechanism in various kinds of tumors, which has a wide foreground of investigation. In this paper, we make a comprehensive review of the association of MIM with cancer development, in order to provide the theoretical basis and new strategies for application of MIM proteins in cancer diagnosis and treatment.

BACKGROUND: Embryonic stem cells (ESCs), the seed cells of all mature cells in vivo, are useful tools for nerve transplantation and developmental gene function research. Notch1 signaling pathway is the key pathway to control the ordered neural development and differentiation of many kinds of neural cells, however, there is no report on the dynamic expression of Notch1 signal during the ESC differentiation to date. OBJECTIVE: To investigate the expression of Notch1 protein, transmembrane signal transduction molecule, during directional differentiation of embryonic stem cells into neural cells. DESIGN, TIME AND SETTING: Cell research was carried out between October 2003 and October 2004 at Zhongshan Ophthalmic Center, SUN Yat-sen University, Guangzhou, Guangdong Province, China. MATERIALS: BALB/C mouse embryonic stem cell line Ⅵ (passage 11)was obtained from experimental animal center of SUN Yat-sen University, provided by professor Huang Bing. ESC culture medium was high-glucose DMEM medium with 20% bovine serum and 106 IU/L mouse leukemia inhibitory factor. Induced differentiation medium was high-glucose DMEM medium with 20% fetal bovine.serum and 5×107 mol/L retinoid acid(RA). METHODS: Passage 11 ESCs were resuscitated and incubated by ESC culture medium in incubator at 37℃ with 5% CO2. Passage 11 ESCs were subcultured after 2 or 3 days and RA was added into medium to induce differentiation. Three time points for observation were established: induced for 1, 5 and 9 days. MAIN OUTCOME MEASURES: Morphological changes were observed under inverted phase contrast microscope, MAP-2 antigen expressed in differentiated cells was detected by immunofluorescence method. Immunocytochemistry, Western Blot, flow cytometry assay were used to investigate the Notch1 protein expression. RESULTS: ESCs presented clone-like growth. After induced by RA for 9 days, single neural network was achieved around most of the cell clusters. With the prolongation of induction, MAP-2 positive neural cells increased gradually. Almost all ESC clones expressed Notch1 protein strongly or positively, but Notehl protein expression decreased gradually after induced differentiation (P < 0.01). CONCLUSION: Notch1 signal shuts off progressively during induction of ESCs into neural cells, which suggests Notch1 may play an important role in the differentiation of ESCs into neural cells.

AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.

Objective To detect the combining capacity of peripheral blood NF-E2-related factor 2 (Nrf2)of arsenic-exposed residents in the coal-contaminated arsenism area in Guizhou with the sequence of downstream antioxidant response element (ARE) as well as antioxidase gene expression,and to provide a basis for in-depth revelation of arsenic oxidative damage mechanism to human body.Methods Jiaole and Changqing villages in coal-burning-borne arsenism areas in Xingren County of Guizhou were selected as the survey spots,and 161 cases of arsenic-exposed residents were selected as the arsenic exposed group on the basis of physical examination.They were divided into non-patient group (21 cases) and patient group (140 cases) according to the Diagnostic Criteria of Endemic Arsenism (WS/T 211-2001),and the patient group was further divided into mild hepatosis group (52 cases),moderately severe hepatosis group (36 cases) and non-apparent hepatosis group (52 cases) according to the Diagnostic Criteria of Occupational Chronic (GBZ 59-2010).Moreover,45 residents from one village neighboring to non-epidemic area were selected as controls.The hemocyte nucleoprotein was extracted from peripheral blood in the sampling subjects.The combining capacity of peripheral blood Nrf2-ARE was tested by electrophoretic mobility shift assay (EMSA),and the relative expression quantity of Cu/Zn superoxide dismutase (Cu/Zn-SOD) and glutathione peroxidase 1 (GSH-Pxl) mRNA was tested with real-time fluorescence quantification PCR (qPCR).Results The testing results of Nrf2-ARE combining capacity showed that the difference of Nrf2-ARE combining capacity between groups was statistically significant (F =116.033,P ＜ 0.05).Compared with the control group (3.14 ± 1.34),the Nrf2-ARE combining capacity was higher in the non-apparent hepatosis group (5.17 ± 2.06),mild hepatosis group (13.13 ± 4.84) and moderately severe hepatosis group (32.35 ± 14.76,all P ＜ 0.05);compared with the non-patient group (5.15 ± 3.23) and non-apparent hepatosis group,the Nrf2-ARE combining capacity of mild hepatosis group and moderately severe hepatosis group was higher (all P ＜ 0.05);compared with mild hepatosis group,the Nrf2-ARE combining capacity of moderately severe hepatosis group was higher (P ＜ 0.05).The results of Cu/Zn-SOD and GSH-Pxl mRNA expression showed the relative expression quantities of Cu/Zn-SOD [Median (M):1.127 8,1.257 8,1.632 0] and GSH-Pxl (M:1.334 5,1.940 9,2.062 6) mRNA of non-apparent hepatosis,mild hepatosis,moderately severe hepatosis groups were higher than those of the control groups (M:0.961 8,0.884 3),respectively,and their differences were statistically significant (x2 =13.065,19.934,all P ＜ 0.05).The relative expression quantities of GSH-Pxl mRNA of mild hepatosis group and moderately severe hepatosis group were higher than that of the non-patient group (M:1.248 4),and their differences were statistically significant (all P ＜ 0.05).The correlation analysis indicated the Nrf2-ARE combining capacity was positively related to the Cu/Zn-SOD and GSH-Px1 mRNA expression (r =0.271,0.292,all P ＜ 0.01).Conclusion The increase of Nrtf2-ARE combining capacity by arsenic participates is involved in the regulation of Nrf2 downstream antioxidase gene expression,and this process possibly participates in occurrence and development of coal-burning-borne arsenism and hepatic injury.

Objective:To gain insight into the mechanism responsible for clearance of natural hepa DNA virus infections.Methods:A group of seven 2～3 month old ducks were infected intravenously with 10～20 ml DHBV positive serum containing 5?10 7 genomes/ml.Following inoculation,ducks were bled at weekly intervals to obtain serum samples for analysis of DHBV DNA and DHBsAg and anti DHBV antibodies.Peripheral blood mononuclear cells were collected at 10,35 days postinoculation(p.i) and used to conduct antigen specific blastogenesis assay.Liver samples were obtained at 5,30,60 days p.i for analysis of DHBV DNA and surface antigens and liver histology.Results:Infection of all 7 animals with approximately 5?10 8～1?10 9 DHBV genomes led to a transient viremia after an incubation period of 1 to 2 weeks.Liver samples contained multiple copies of all of the expected species of DHBV DNA replicative intermediates,including DHBV cccDNA during the peak of viremic phase.Further analysis showed that the absence of a prolonged viremia could be explained by immediate antigen specific blastogenesis and high titer of antibody response.Meanwhile,there was no obvious evidence of liver cell injury during transient DHBV infection.Conclusion:These results demonstrate that noncytopathic antiviral mechanisms make a role in hepa DNA virus clearance.

Objective To develop a quick quantitative detecting method for point of care testing (POCT) of human serum procalcitonin (PCT) by fluorescence immunochromatographic technology.Methods Applying a double-antibody sandwich immunofluorescent assay (one antibody coated on the nitrocellulose membrane and the other antibody labeled with fluorescent micropaticles) to develop a PCT quantitative detecting kit by immunochromatography technology.The kit was used to test PCT in 472 serum samples from suspected bacterial infection patients of Guangzhou Red Cross Hospital,including 240 male and 232 female patients.The methodology and diagnostic performance were evaluated in the aspects of linearity,precision,accuracy,specificity,stability experiments and comparison with foreign PCT detecting kits.Results The report range of the PCT quantitative diagnostic kit was 0.1-125.0 μg/L The coefficient of variation (CV)values of repeat 20 tests for low,median,and high concentration control samples respectively were all less than 15％ and bias can be acceptable (P ＞ 0.05).Common interfering substances in human serum specimens such as bilirubin (2.0 g/L),triglyceride (30.0 g/L) and cholesterol (15.0 g/L) were found no significant affect on quantitative detection of PCT.The shelf time of the PCT diagnostic kit should be longer than 12 months as the relative deviation of detected concentrations of 0.5,1.0,22.0,65.0 μg/L PCTcontrol sample can be controlled less than 20％ within 14 months.Considering VIDAS BRAHMS PCT to be the standard quantitative test for PCT,472 serum samples were detected by both our kit and the control VIDAS BRAHMS PCT kit simultaneously,which showed high correlation (YVIDAS =0.180 + 1.006Xwondfo,R2 =0.988,P ＜ 0.01) and low deviation (Z =-1.6,P ＞ 0.05) without statistic significance between two methods.And the results of these two diagnostic kits showed good consistency as the area under curve of the receiver operating characteristic (ROC) of Wondfo-PCT at the three cut-off values (0.5,2.0,10.0 μg/L)were 0.997,0.994,0.998 respectively,P ＜ 0.01,using diagnostic result of the control product as standard.Kappa values were 0.899,0.905,0.973 respectively.Conclusions The method of quantitative detection of PCT by fluorescence immunochromatography for POCT was established in this study.All the observed indicators reached the clinical diagnostic requirements and can be applied for the quick detection of clinical human serum PCT.

Objective To analyze the efficacy of electric sacral neuromdulation and resiniferatoxin in patients with female overactive bladder.Methods 32 cases with IOAB female patients accepted percutaneous test sitmulation of the electric sacral nerves at S3 ,and treated by intravesical instillation with 100ml of 100nmol/L RTX.The effica- cy of voiding status were evaluated.The improvement of female patients life were evaluated comparing the rating of depression and anxiety.Results There were significant improvements in 32 cases in variables included the number of voiding,volume voided and signs every day and urgent uresis.In the rating of depression and anxiety,the patients improved a litter and still had stimulating symptom in urethra and bladder.Conclusion The treatment of IOAB with single administratoon of electric sacral neuromdulation and resiniferatoxin is effective,and can successfully im- prove the symptom with little side effects.

OBJECTIVE To study the audiological and etiological characteristics of infants failed to pass hearing screening. METHODS 126 infants received audiological diagnostic tests,including auditory brainstem response(ABR),40 Hz auditory event related potential(40 Hz AERP),distortion product otoacoustic emissions(DPOAE),tympanometry and acoustic reflex. The degrees and types of the hearing loss,and etiological characteristics were analyzed. RESULTS Among 126 infants (252 ears),61 were diagnosed with sensorineural hearing loss(48.41%),48 were conductive hearing loss(38.09%),and 17 were found to have normal ABR thresholds(13.49%). The hearing loss was associated with various factors,including history of infection during pregnancy(21 cases),threatened abortion(9 cases),pregnancy with age at or over 35(6 cases),extension of pregnancy(7 cases),history of systematic diseases(10 cases),history of neonatal jaundice(13 cases),history of asphyxia and hypoxia(18 cases),premature and low birth weight neonates(8 cases),neonatal diseases (8 cases),family history of deafness(5 cases),craniofacial deformity(3 cases),central nervous system disorder(6 cases),and 9 cases were second child. CONCLUSION The infants who failed to pass hearing screening have various etiology characteristics in hearing loss. The infants associated with risk factors were mostly found to have sensorineural hearing loss.