The incidence of hearing impairment in neonatal intensive care unit (NICU) was much higher than that of well-baby nursery. The incidence of the former was 2%-4%, whereas that of the latter was 0.1%-0.3%. Furthermore, the incidence of auditory neuropathy spectrum disorder, progressive and delayed hearing loss was also higher than those of other infants. Therefore, the newborn hearing screening program in NICU has become an important part of pediatric audiology. In this paper, we reviewed the previous studies and suggested the special procedure of hearing screening and following-up which based on the physiological and pathological characteristics of NICU in order to detect hearing impaired as early as possible.
Hearing Disorders ; diagnosis ; Hearing Tests ; Humans ; Incidence ; Infant, Newborn ; Intensive Care Units, Neonatal ; Neonatal Screening

Objective To investigate the clinical features of moyamoya disease complicated with Graves′disease and the efficacy of extra-and intra-cranial revascularization. Methods The clinical data of 4 patients with moyamoya disease complicated with Graves′disease were analyzed retrospectively. Among them,three were females and one was a male. Their mean age was 32 ± 7 years. After medical treatment, their thyroid function was normal. The patients were treated with superficial temporal artery-middle cerebral artery bypass grafting. Results (1) Three patients showed cerebral infarction and one showed frequent transient ischemic attack. DSA confirmed that 2 patients had unilateral moyamoya disease and 2 had bilateral moyamoya disease. Head MRI revealed brain infarcts. (2) The thyroid function was normal after drug treat-ment,the symptoms of moyamoya disease were stable in 3 cases. One patient had high metabolic symptoms, such as high fever and accelerated heart rate within one week after procedure. The patients were followedup for 6 to 18 months,one was good,3 were excellent,and there was no recurrence of Graves′disease. Postoperative head MRI revealed that the 4 patients did not have new brain infarcts. MRA showed that the arterial filling in cerebral sulci in the ischemic lesion areas was obviously improved compared with that before procedure. Retrograde filling of the ipsilateral middle cerebral artery M2-M3 segment was observed in 2 patients. Postoperative single photon emission computed tomography perfusion imaging revealed that the ischemic perfusion lesions on the operated sides were obviously improved compared with those before procedure. Conclusion When complicated with Graves′ disease,the symptoms of moyamoya disease will aggravate. It manifests as acute and chronic cerebral ischemia. After controlling the symptoms of hyperthyroidism,most cerebral ischemic symptoms can be alleviated. Superficial temporal artery-middle cerebral artery bypass grafting may establish an effective collateral circulation and improve the clinical symptoms.

Objective To analyze the characteristics of spontaneous otoacoustic emission in full-term newbo‐rns .Methods The Capella OAE equipment (Madsen ,Denmark) was used to test Spontaneous Otoacoustic Emission (SOAE) in 147 cases (236ears) who have passed the newborn hearing screening with TEOAE(Transient Evoked Otoacoustic Emissions) .Results The SOAE incidence was 56 .77% (male 41 .51% ,female 69 .23% ;left ear 49 .14% ,right ear 64 .17% ) .It was significantly higher in females (P<0 .05) and in right ear (P<0 .05) .The av‐erage amplitude was 11 .78 ± 8 .36 dB SPL( 11 .73 ± 8 .25 dB in male ,11 .81 ± 8 .43 dB SPL in female;11 .97 ± 8 .56 dB SPL in the left ear ,11 .65 ± 8 .22 dB SPL in the right ear) .There were significant differences in genders(P<0 .01) .The frequency of SOAE focused on 3 .2~ 3 .7 kHz(2 .9~3 .4 kHz in males ,3 .4~3 .9 kHz in females ;3 .2~3 .7 kHz in the left ears ,3 .2~3 .6 kHz in the right ears) .There were significant differences in genders(P<0 .01) .The average peak of SOAE was 3 .70 ± 2 .75(3 .86 ± 2 .87 in males ,3 .62 ± 2 .70 in females;3 .70 ± 3 .02 in the left ears ,3 .70 ± 2 .55 in the right ears) .There were no significant differences in genders and laterality .Conclusion The characteristics of SOAE in full-term newborns include higher incidences ,multiple peaks and high frequency distribution .

Objective To establish normal reference intervals of plasma and urine neutrophil gelatinase-associated lipocalin (NGAL) in children′s hospital.Methods A total of 183 fresh EDTA anticoagulant samples and 125 fresh urine in healthy children were collected from May 2014 to October 2014.According to the CLSI C28-A2 ,the unilateral upper limit 95% was established the normal reference value in different age group.Results There was significant difference in four groups (P<0.05).The normal reference intervals of plasma NGAL in healthy children:0 to <7 months;<291.28 μg/L;7 months to <5 years old;<150.87 μg/L;5 years old to <9 years old:<127.93 μg/L;9 years old to ≤16 years old:<161.74 μg/L;the normal reference intervals of healthy children urine NGAL:0 to <7 months:<257.31 μg/L;7 months to <5 years old:<201.55 μg/L;5years old to <9 years old:<197.69 μg/L;9 years old to ≤16 years old:<151.46 μg/L.Plasma and urine NGAL results in neonatal group were higher than the other three groups.Conclusion The normal reference intervals of plasma and urine NGAL in children′s hospital is established.this could provide clinical evidence for the diagnosis and treatment of acute renal injury in pediatric patients.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Aim To investigate the molecular mechanisms of differentiation in human leukemia HL-60 cells induced by diallyl disulfide(DADS)using suppression subtractive hybridization(SSH).Methods In our privious study,the subtractive cDNA library was constructed successfully and efficiently. 30 clones were randomly analyed with restriction enzyme.The inserts of cDNAs were analyzed by restrictive enzyme EcoR I.Positive clones were sequenced and the homology of resulting cDNA sequences were analyzed through bioinformatics software Blastn.Results 18 clones contained 100～600 bp cDNA inserts.10 differantiation genes were obtained and involved in cell cycle,signal transduction,metabolism and RNA binding.And 3 of 10 genes,p21,STAT1 and CAMTA1 were up-regulated and detected by RT-PCR,the results matched with SSH.Conclusion sThere are tight correlation between the differentiation induced by DADS and three-upregulated gene:p21,STAT1 and CAMTA1.

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.

OBJECTIVETo explore the mechanism of electroacupuncture at Zusanli (ST 36) on regulation of intestinal inflammatory reaction in rats with acute pancreatitis.

METHODSFifty-four SD rats were randomly divided into a severe acute pancreatitis (SAP) group, an electroacupuncture (EA) group and a sham-operation (SO) group, 18 cases in each group. 3.5% sodium cholate was used to made SAP model by retrograde injecting in cholangiopancreatic duct. After the success of model making, the EA group was treated with EA at bilateral Zusanli (ST 36) for 30 min. The SO group and the SAP group were fixed at the same time for 30 min without treatment. All the rats were killed at 3 h, 6 h and 12 h after modeling in batches. The pathological changes of pancreatic tissue and intestinal epithelium were observed, and the expression of small intestinal occludin protein and nuclear factor kappa-B (NF-kappaB) were detected by immunohistochemical SP method.

RESULTSThe pathologic score and the expression of small intestinal NF-kappaB p65 at 3 h, 6 h and 12 h after modeling in the EA group and the SO group were significantly lower than those in the SAP group (all P < 0.05), and the expression of small intestinal occludin protein in the EA group and the SO group were significantly higher than that in the SAP group (all P < 0.05).

CONCLUSIONElectroacupuncture at Zusanli (ST 36) can alleviate pancreatic injury by reducing the expression of NF-kappaB p65 and enhancing the expression of occludin protein in the intestinal epithelium in the SAP model rats.

Acupuncture Points ; Acute Disease ; therapy ; Animals ; Electroacupuncture ; Humans ; Intestine, Small ; metabolism ; Male ; NF-kappa B ; genetics ; metabolism ; Occludin ; genetics ; metabolism ; Pancreatitis ; genetics ; metabolism ; therapy ; Rats ; Rats, Sprague-Dawley

Aim To investigate JAKs/STATs signal transduction change in HL-60 cells differentiation induced by diallyl disulfide(DADS)and molecular mechanism regulating the differentiation.Methods After incubation of HL-60 cells with DADS or AG490(50 ?mol?L -1),the cell differentiation indexes were observed by cytomorphology, NBT reduction ability assay,cell myeloid differentiation antigen CD11b by flow cytometry. Kinase activity of JAKs/STATs was tested by western-blotting and expressions of nucleus transcription genes stats,c-myc,c-fos,c-jun were detected by immumocyte chemistry method.Results Cell differentiation index changes indicated that HL-60 cells were induced differentiation toward granulocytic lineage by DADS, Western blot test demonstrated that constitive phosphorylation of Jak1,stat3 kinase was suppressed. Stat3,c-myc gene expression decreased and c-fos, c-jun gene expression increased in HL-60 cells treated with DADS through immunocyte chemistry.Conclusion Inhibition of phosphative Jak1, Stat3 was involved in HL-60 cells differentiation induced by DADS, its molecular mechanism might be related to modulation of gene expression associated proliferation and differentiation,and inhibition of DNA systhesis, induction differentiation.

Accidents, Occupational ; statistics & numerical data ; Adolescent ; Adult ; Aged ; Female ; Follow-Up Studies ; Hand Injuries ; epidemiology ; etiology ; Humans ; Male ; Middle Aged ; Prognosis ; Retrospective Studies ; Young Adult