Objective　To find out the morbidity and main pathogens of ventilator-associated pneumonia(VAP) in PICU.Methods　44 VAP cases were reviewed.Results　44 VAP cases were diagnosed and analyzed from 1998, 2 to 2001,1,the morbidity of VAP was 69.8%.The predominant pathogen was Pseudomonas aeruginosa.Conclusion　It has reference value in consideri ng the possible pathogens of pneumonia.

Small for gestational age ( SGA ),one of the major adverse pregnancy outcomes, significantly increases the risk of perinatal death and metabolic diseases in adulthood. It is of great significance to strengthen early surveillance and intervention for SGA prevention. Dyslipidemia during pregnancy, as a common metabolic disorder, has been considered to correlate with the increased risk of SGA; however, the epidemiological evidence is still controversial. We have systematically reviewed the recent studies related to the association between serum lipid level during pregnancy and the risk of SGA, so as to provide reference for prevention and intervention of SGA.

Objective To investigate the status of knowledge and performance on Chinese Heart Failure Diagnosis and Treatment Guideline (2014 version) in general practitioners of Shanghai Pudong communities.Methods The survey was conducted from April to June in 2014 with a self-designed questionnaire.Total 390 general practitioners (GPs) in Pudong New Area were selected by cluster sampling method.The contents of questionnaire included:diagnosis and differential diagnosis,drug therapy,non drug therapy of chronic heart failure.Result Total 385 questionnaires were retrieved with a response rate of 98.7％ (385/390).The results showed that in aspect of diagnosis and differential diagnosis,373 (96.9％) Gps made the diagnosis based on history and physical examination,171 (44.4％)Gps never used BNP or NTPro-BNP tests,280 (72.7％)GPs did not know how to identify systolic or diastolic heart failure,86 (22.3％)Gps made the differential diagnosis according to the EF value.In aspects of drug therapy,the rate of beta blockers use was 10％-30％ in 284 (73.8％) Gps,149 (38.7％) Gps did not use beta blockers because of not knowing the contraindications,289 (75.1％) Gps used a maximum dose of betaloc for 25-50 mg,no one used 101-200 mg,242 (62.9％)Gps did not know the target dose of betaloc,the rate of ACEI/ARB use was 10％-30％ in 330 (85.7％) Gps,258 (67.0％) Gps would increase the dose but not knowing the target dose.The main reason for not using the target dose of Betaloc and ACEI/ARB was not knowing the dose.In aspect of non-drug therapy:240 (62.3％)Gps never heard of cardiac resynchronization therapy (CRT) and 271 (70.4％)Gps never heard of implantable cardioverter defibrillator (ICD).The senior rank GPs grasped the guideline much better than Gps with primary and intermediate professional ranks.Conclusion General practitioners in community health centers should further study the guideline of heart failure,particularly need to strengthen the knowledge and ability of drug therapy.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Objective To investigate the antitumour effects of transfected gut-enriched Krüppellike factor(GKLF) on human gastric carcinoma cell line SGC-7901 in vitro and in vivo. Methods The expression of GKLF mRNA and protein in human gastric carcinoma cell line SGC-7901 were detected before and after transfection by real-time fluorescence quantitative PCR and Western blot,respectively. Proliferation and invasion in SGC-7901 were measured respectively by MTT assay, flow cytometry, colony formation assay and cell invasion assay after transfected with GKLF. The growth of xenograft was observed, the microvessel density(MVD) of xenograft tissue was determined by immunohistochemistry. Results The GKLF mRNA and protein in SGC-7901 were overexpressed after transfected with GKLF(P＜0.05). The proliferative speed of SGC7901-pcDNA3.1-GKLF group was markedly lower than that of SGC-7901 and SGC7901-pcDNA3.1 groups (P＜0.05). Transfected with GKLF caused part of the G0/G1 arrest, decreased clone formation rate and the invasion ability (P＜0.05). The growth speed of xenograft in SGC7901-pcDNA3.1-GKLF group was lower, the weight and MVD of xenograft tissue in SGC7901-pcDNA3. 1-GKLF group were less (P＜ 0. 05).Conclusion Transfected with GKLF maysuppress proliferation and invasion in human gastric carcinoma cell line SGC-7901, inhibit the growth and the angiogenesis of xenograft in nude mice.

As a kind of additive in feed of monogastric animals, the application of natural phytase is limited due to its disadvantages. In this paper, the strategies of phytse reform was introduced. Furthermore, the research and progress on protein engineering of feed phytase was reviewed, including phytase over-expression, phytase thermostability, catalytic efficiency and optimum pH.

Objective To investigate the efficacy and the mechanism of different dose hepatitis B immunoglohulin(HBIG)on prevention of HBV intrauterine infection and HBV S gene mutation. Methods HBV carrier mothers were randomly divided into three groups.Eighty-one HBsAg carrier pregnant women were divided into HBIG A group.HBIG B group and control group.Each subject in the HBIG A group received 200 U or 400 U(for HBsAg and HBeAg double positive carrier)intra muscularly at 3,2,1 month before delivery.Each subject in the HBIG B group received 200 U intra muscularly at 3,2,1 month before delivery.The subjects in the control group did not receive any treatment.Maternal blood samples were taken before HBIG injection and at delivery.Neonatal blood samples of all newborn infants after birth were taken before immunopropbylaxis.Their sera were ob tained to test HBV markers by enzyme immunoassay(EIA)and HBV DNA by fluorescence quantita- tive polymerase chain reaction(FQ-PCR),then to amplify and sequence HBV S gene region.Results The rate of HBV intrauterine infection in the HBIG group(14.5%)was lower than that in the control group(35.7%)(X~2=4.896,P=0.027).The rate of HBV intrauterine infection of newborns from HBsAg and HBeAg double positive carrier mother in the HBIG A group(37.5%)were lower than control group(100.0%)(X~2=7.273,P=0.007),while the rate was no different in the HBIG B group(71.5%)and the control group(X~2=2.637,P=0.104).Maternal HBsAg titer and HBV DNA level were of no difference among three groups before HBIG injection.Maternal HBsAg titers and HBV DNA levels of the HBIG A group were lower than those of the HBIG B group and the con- trol group at delivery.Among the 26 neonatal serum samples in the HBIG A group,10(38.5%)were positive for anti-HBs,while in the HBIG B group and in the control group,no neonatal serum sam- ples was positive.There was no significant difference of nucleotide and amino acid changes in the S gene between the HBIG group and the control group.Conclusions HBV infection in the uterus may be interrupted by injection HBIG intramuscularly before delivery.More efficacy would be found using variable HBIG dose according to different HBV virema and must be once more again injected just he- fore one week of delivery;anti-HBs transported to the fetus via the placenta and it's may be the im- portant mechanism of HBIG prevention.Asymptomatic HBsAg carrier mother received injections of HBIG before delivery should not influence HBV S gene mutation.Gene mutation of HBV is not the main factor in intrauterine transmission of HBV.

Object To study the chemical constituents of cytotoxicity portion in the bark of Reevesia longipetiolata Merr et Chun Methods The constituents were isolated and purified by various chromatographic methods, such as gel column chromatography under normal pressure and increased pressure, Sephadex LH 20 column chromatography and HPLC, and the structures were identified by physicochemical properties and spectral analysis Results Five compounds were obtained in the ethyl acetate fractions and identified as ? sitosterol (Ⅰ), daucosterol (Ⅱ), betulinic acid (Ⅲ), lupeol (Ⅳ) and (+) catechin (Ⅴ) Conclusion All above compounds are obtained from the plants of Reevesia Lindl for the first time, and their cytotoxicity is discussed

Cartilage antuumor component (CATC) was isolated from a 1 mol/L guanidine hydrochloride extract of bovine cartilage by acetone fractioned precipitation and superfiltration. Using human skin fibroblasts as a normal control, it was demonstrated that CATC inhibited the DNA synthesis of Hela, QGY7703 tumor cell lines and bovine artery endothelial cells, but accelerated the normal cells, when the concentration was below 1250 ?g/ml. At the concentration of 5 000 ?g/ml, CATC inhibited the two cell lines. With human tumor stem cell assay, CATC inhibited the stem cell growth of Hela and QGY7703 cell lines. These suggest that CATC has the effects of inhibiting angiogenesis and tumor cells.

Objective To observe the acupoint massage on gestational diabetes about mellitus and pregnancy outcome.Methods Using simple random sampling method,96 cases of gestational diabetes mellitus were randomly divided into the observation group and control group.The control group were given the conventional treatment, the observation group were given acupoint massage,pregnancy outcomes and blood glucose in the two groups before and after intervention were compared.Results The two groups after treatment of fasting blood glucose,2h postprandial blood glucose and glycated hemoglobin levels were significantly lower than that those of before treatment, but the observation group[(6.92 ±0.66)mmol/L,(8.12 ±0.70)mmol/L,(6.88 ±0.39)%]improved significantly better than those of the control group[(7.93 ±1.03)mmol/L,(9.54 ±1.33)mmol/L,(7.95 ±0.63)%],the difference was statistically significant(t =3.27,2.39,2.73,all P<0.05).The observation group after treatment,the 2H C peptide levels in fasting serum C peptide and postprandial[(0.50 ±0.07)nmol/L,(0.54 ±0.06)nmol/L]signifi-cantly increased than those of the control group after treatment[(0.38 ±0.04)nmol/L,(0.49 ±0.04)nmol/L],with statistical significant differences(t=2.41,2.15,P<0.05).The patients in the control group after treatment,statistical average daily insulin dosage was (55.84 ±8.73) u,the observation group was (32.24 ±5.03) u,the observation group was significantly lower than that of the control group,the difference was statistically significant(t=13.84,P<0.05).The observation group cesarean section,polyhydramnios,postpartum hemorrhage,fetal distress,pregnancy induced hypertension incidence rate(12.50%,4.17%,2.08%,4.17%,0%) were lower than those of the control group(29.17%,16.67%,12.50%,22.92%,12.50%),the difference was statistically significant(χ2 =4.042, 3.877,3.852,7.206,6.400,all P<0.05).Conclusion The acupoint massage therapy can effectively enhance the gestational diabetes treatment effect,improve the pregnancy outcome in patients with gestational diabetes mellitus.