1.Pathogenic anlysis of 44 cases with ventilator-associated pneumonia in PICU
Hui CHEN ; Yujie QI ; Rong GENG ; Suyun QIAN ; Xiannan CHEN
Chinese Pediatric Emergency Medicine 2001;8(1):13-15
Objective To find out the morbidity and main pathogens of ventilator-associated pneumonia(VAP) in PICU.Methods 44 VAP cases were reviewed.Results 44 VAP cases were diagnosed and analyzed from 1998, 2 to 2001,1,the morbidity of VAP was 69.8%.The predominant pathogen was Pseudomonas aeruginosa.Conclusion It has reference value in consideri ng the possible pathogens of pneumonia.
2.Association between maternal blood lipid level during pregnancy and risk of small-for-gestational-age infants
CHEN Hui Qi ; LUO Qiong ; CHEN Guang Di
Journal of Preventive Medicine 2021;33(1):41-45
Small for gestational age ( SGA ),one of the major adverse pregnancy outcomes, significantly increases the risk of perinatal death and metabolic diseases in adulthood. It is of great significance to strengthen early surveillance and intervention for SGA prevention. Dyslipidemia during pregnancy, as a common metabolic disorder, has been considered to correlate with the increased risk of SGA; however, the epidemiological evidence is still controversial. We have systematically reviewed the recent studies related to the association between serum lipid level during pregnancy and the risk of SGA, so as to provide reference for prevention and intervention of SGA.
3.Status of knowledge and performance of chronic heart failure guideline in general practitioners of Shanghai Pudong communities
Lan NI ; Hui ZHAO ; Jinhua XUE ; Qi XU ; Fengyuan CHEN
Chinese Journal of General Practitioners 2015;14(5):351-357
Objective To investigate the status of knowledge and performance on Chinese Heart Failure Diagnosis and Treatment Guideline (2014 version) in general practitioners of Shanghai Pudong communities.Methods The survey was conducted from April to June in 2014 with a self-designed questionnaire.Total 390 general practitioners (GPs) in Pudong New Area were selected by cluster sampling method.The contents of questionnaire included:diagnosis and differential diagnosis,drug therapy,non drug therapy of chronic heart failure.Result Total 385 questionnaires were retrieved with a response rate of 98.7% (385/390).The results showed that in aspect of diagnosis and differential diagnosis,373 (96.9%) Gps made the diagnosis based on history and physical examination,171 (44.4%)Gps never used BNP or NTPro-BNP tests,280 (72.7%)GPs did not know how to identify systolic or diastolic heart failure,86 (22.3%)Gps made the differential diagnosis according to the EF value.In aspects of drug therapy,the rate of beta blockers use was 10%-30% in 284 (73.8%) Gps,149 (38.7%) Gps did not use beta blockers because of not knowing the contraindications,289 (75.1%) Gps used a maximum dose of betaloc for 25-50 mg,no one used 101-200 mg,242 (62.9%)Gps did not know the target dose of betaloc,the rate of ACEI/ARB use was 10%-30% in 330 (85.7%) Gps,258 (67.0%) Gps would increase the dose but not knowing the target dose.The main reason for not using the target dose of Betaloc and ACEI/ARB was not knowing the dose.In aspect of non-drug therapy:240 (62.3%)Gps never heard of cardiac resynchronization therapy (CRT) and 271 (70.4%)Gps never heard of implantable cardioverter defibrillator (ICD).The senior rank GPs grasped the guideline much better than Gps with primary and intermediate professional ranks.Conclusion General practitioners in community health centers should further study the guideline of heart failure,particularly need to strengthen the knowledge and ability of drug therapy.
4.Ultrasound-guided double-tract percutaneous cholecystostomy combined with choledochoscopic gallbladder-preserving cholecystolithotomy for elderly patients with acute calculous cholecystitis
Hua WANG ; Qi CHEN ; Tao WANG ; Lijun TANG ; Hui ZHANG
Chinese Journal of Digestive Surgery 2015;14(2):149-151
Objective To investigate the clinical efficacy of ultrasound-guided double-tract percutaneous cholecystostomy combined with choledochoscopic gallbladder-preserving cholecystolithotomy for the elderly patients with acute calculous cholecystitis.Methods The clinical data of 35 elderly patients with cholecystolithiasis who were admitted to the General Hospital of Chengdu Military Command from January 2012 to December 2013 were retrospectively analyzed.All the 35 patients received ultrasound-guided double-tract percutaneous drainage,and then received choledochoscopic gallbladder-preserving cholecystolithotomy.The long-term oral use of anti-inflammatory and cholagogue medications after operation reduced recurrence of cholecystolithiasis.All the patients were followed up by telephone interview and outpatient examination till June 30,2014.Results All the 35 patients undergoing successfully the ultrasound-guided double-tract percutaneous cholecystostomy.Of the 35 patients,1 patient with the puncture bleeding was cured successfully by symptomatic treatment,1 patient was treated by cholecystectomy due to the unformed sinus tract under costal margin,and other 34 patients underwent successfully cholecystolithotomy.The follow-up was carried out for 4 to 24 months and 1 patient was diagnosed as with recurrence of cholecystolithiasic.Conclusion Ultrasound-guided double-tract percutaneous cholecystostomy combined with choledochoscopic gallbladder-preserving cholecystolithotomy for elderly patients with acute calculous cholecystitis is safe and feasible,with an advantage of promotional value.
5.Effect of electro-acupuncture pretreatment on endoplasmic reticulum stress during global cerebral ischemia-reperfusion in rats
Huailong CHEN ; Hui QI ; Xiaojie LIU ; Mingshan WANG
Chinese Journal of Anesthesiology 2014;(3):331-333
Objective To evaluate the effect of electro-acupuncture pretreatment on endoplasmic reticulum stress during global cerebral ischemia-reperfusion (I/R ) in rats .Methods One hundred and forty-four adult male Sprague-Dawley rats ,weighing 400-500 g ,were randomly divided into 3 groups ( n=48 each) using a random number table:sham operation group (group S ) , I/R group and electro-acupuncture pretreatment group (group EA) .Global cerebral I/R was induced by 4-vessel occlusion method .Bilateral vertebral arteries were permanently occluded by cauterization and bilateral carotid arteries were occluded for 5 min , followed by reperfusion .Electro-acupuncture of Dazhui and Baihui acupoints lasting for 30 min was performed once a day for 5 consecutive days starting from 5 days before ischemia in group EA .At 6 ,12 ,24 and 48 h of reperfusion ,12 rats were sacrificed in each group and hippocampi were removed for microscopic examination and for determination of apoptosis rate (by TUNEL ) and expression of growth arrest-and DNA damage-inducible gene 153 (GADD153 ) protein (by Western blot ) .Results Compared with group S ,the apoptosis rate was significantly increased and the expression of GADD153 protein was up-regulated at 6 ,12 ,24 and 48 h of reperfusion in I/R and EA groups ( P<0.05) .Compared with group I/R ,the apoptosis rate was significantly decreased and the expression of GADD 153 protein was down-regulated at 6 ,12 ,24 and 48 h of reperfusion in group EA ( P< 0.05) .The pathological changes were significantly attenuated in group EA as compared with group I/R .Conclusion Electro-acupuncture pretreatment can down-regulate the expression of GADD 153 protein , reduce endoplasmic reticulum stress , and decrease cell apoptosis ,thus attenuating global cerebral I/R injury in rats .
6.Effect of total nutrient admixture on lipid metabolism in acute hepatic failure rats
Yumei QI ; Ming ZHANG ; Yajun CHEN ; Jin XU ; Hui YANG
Chinese Journal of Clinical Nutrition 2009;17(1):41-44,后插1
Objective To study the effect of total nutrient admixture (TNA) on lipid metabolism in rats with acute hepatic failure (AHF). Methods Fifty-six male Wistar rats were randomly divided into four groups: normal diet group, nitrogen-free diet group, fat-free nutrient admixture group, and TNA group. All rats were injected with D-galac- tosamine to induce AHF model Meanwhile, 6 healthy Wistar rats were used as control group. TNA provided energy 221.75 kJ (1 kcal=4.184 kJ), nitrogen 0.365 g, nitrogen to energy ratio 1:145, amino acids 2.28 g (including branched-chain amino acid 0.70 g), glucose 7.85 g, and fat 1.25 g on a daily basis. After 10 days of the operation of Jugular vein puncture tube, blood glucose, blood lipid, liver and renal function were determined. Results The blood glucose level was significantly higher in TNA group than that in fat-free nutrient admixture group (P < 0.05). The levels of serum triglyceride and cholesterol were highest in fat-free nutrition admixture group, and triglyceride level was signif- icantly higher than that in normal diet group and nitrogen-free diet group (P <0.05). The levels of serum triglyceride and cholesterol were significantly higher in TNA group than those in normal diet group (P <0.05). The levels of ala- nine aminotransferase, alkaline phosphatase, total bilirubin and blood urea nitrogen were lower in TNA group than those in fat-free nutrient admixture group (P < 0.05). Conclusion The nutritional proportion of TNA is suitable for the metabolism disorder of hepatic failure, and therefore TNA can reasonably promote the anabolism and reverse the deteri- oration of hepatic failure in rats.
7.Effects of transfected gut-enriched Krüppel-like factor on growth of human gastric carcinoma cell line SGC-7901 and its xenograft in nude mice
Hui YAN ; Weichang CHEN ; Jiannong CEN ; Hongjie SHEN ; Xiaofei QI
Chinese Journal of Digestion 2011;31(1):30-35
Objective To investigate the antitumour effects of transfected gut-enriched Krüppellike factor(GKLF) on human gastric carcinoma cell line SGC-7901 in vitro and in vivo. Methods The expression of GKLF mRNA and protein in human gastric carcinoma cell line SGC-7901 were detected before and after transfection by real-time fluorescence quantitative PCR and Western blot,respectively. Proliferation and invasion in SGC-7901 were measured respectively by MTT assay, flow cytometry, colony formation assay and cell invasion assay after transfected with GKLF. The growth of xenograft was observed, the microvessel density(MVD) of xenograft tissue was determined by immunohistochemistry. Results The GKLF mRNA and protein in SGC-7901 were overexpressed after transfected with GKLF(P<0.05). The proliferative speed of SGC7901-pcDNA3.1-GKLF group was markedly lower than that of SGC-7901 and SGC7901-pcDNA3.1 groups (P<0.05). Transfected with GKLF caused part of the G0/G1 arrest, decreased clone formation rate and the invasion ability (P<0.05). The growth speed of xenograft in SGC7901-pcDNA3.1-GKLF group was lower, the weight and MVD of xenograft tissue in SGC7901-pcDNA3. 1-GKLF group were less (P< 0. 05).Conclusion Transfected with GKLF maysuppress proliferation and invasion in human gastric carcinoma cell line SGC-7901, inhibit the growth and the angiogenesis of xenograft in nude mice.
9.Preparation of Cartilage Antitumor Component and Its Effects on Human Tumor Cell Lines
Xianrong SHEN ; Fuxing JIA ; Zhijie YU ; Hui XU ; Qi CHEN
Academic Journal of Second Military Medical University 1985;0(06):-
Cartilage antuumor component (CATC) was isolated from a 1 mol/L guanidine hydrochloride extract of bovine cartilage by acetone fractioned precipitation and superfiltration. Using human skin fibroblasts as a normal control, it was demonstrated that CATC inhibited the DNA synthesis of Hela, QGY7703 tumor cell lines and bovine artery endothelial cells, but accelerated the normal cells, when the concentration was below 1250 ?g/ml. At the concentration of 5 000 ?g/ml, CATC inhibited the two cell lines. With human tumor stem cell assay, CATC inhibited the stem cell growth of Hela and QGY7703 cell lines. These suggest that CATC has the effects of inhibiting angiogenesis and tumor cells.
10.Study of β-defensin rBD-2 gene expression in the pulmonary tissues of the fetal, neonatal and adult rats
Hui ZHOU ; Ning HUANG ; Xinnian CHEN ; Qi WU ; Boyao WANG
Chinese Journal of Pathophysiology 2001;17(3):226-229
AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.