Objective　To find out the morbidity and main pathogens of ventilator-associated pneumonia(VAP) in PICU.Methods　44 VAP cases were reviewed.Results　44 VAP cases were diagnosed and analyzed from 1998, 2 to 2001,1,the morbidity of VAP was 69.8%.The predominant pathogen was Pseudomonas aeruginosa.Conclusion　It has reference value in consideri ng the possible pathogens of pneumonia.

Small for gestational age ( SGA ),one of the major adverse pregnancy outcomes, significantly increases the risk of perinatal death and metabolic diseases in adulthood. It is of great significance to strengthen early surveillance and intervention for SGA prevention. Dyslipidemia during pregnancy, as a common metabolic disorder, has been considered to correlate with the increased risk of SGA; however, the epidemiological evidence is still controversial. We have systematically reviewed the recent studies related to the association between serum lipid level during pregnancy and the risk of SGA, so as to provide reference for prevention and intervention of SGA.

Accidents, Occupational ; statistics & numerical data ; Adolescent ; Adult ; Aged ; Female ; Follow-Up Studies ; Hand Injuries ; epidemiology ; etiology ; Humans ; Male ; Middle Aged ; Prognosis ; Retrospective Studies ; Young Adult

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Objective To investigate the antitumour effects of transfected gut-enriched Krüppellike factor(GKLF) on human gastric carcinoma cell line SGC-7901 in vitro and in vivo. Methods The expression of GKLF mRNA and protein in human gastric carcinoma cell line SGC-7901 were detected before and after transfection by real-time fluorescence quantitative PCR and Western blot,respectively. Proliferation and invasion in SGC-7901 were measured respectively by MTT assay, flow cytometry, colony formation assay and cell invasion assay after transfected with GKLF. The growth of xenograft was observed, the microvessel density(MVD) of xenograft tissue was determined by immunohistochemistry. Results The GKLF mRNA and protein in SGC-7901 were overexpressed after transfected with GKLF(P＜0.05). The proliferative speed of SGC7901-pcDNA3.1-GKLF group was markedly lower than that of SGC-7901 and SGC7901-pcDNA3.1 groups (P＜0.05). Transfected with GKLF caused part of the G0/G1 arrest, decreased clone formation rate and the invasion ability (P＜0.05). The growth speed of xenograft in SGC7901-pcDNA3.1-GKLF group was lower, the weight and MVD of xenograft tissue in SGC7901-pcDNA3. 1-GKLF group were less (P＜ 0. 05).Conclusion Transfected with GKLF maysuppress proliferation and invasion in human gastric carcinoma cell line SGC-7901, inhibit the growth and the angiogenesis of xenograft in nude mice.

Recent studies suggested that the prostate cancer may arise from prostate cancer stem cells that share some same characteristics with normal stem cells. The purpose of this study was to detect the differences of Nanog expression between PC3 prostate cancer cell line and its tumor stem cells, and the relationship was preliminarily examined between Nanog and prostate cancer and its tumor stem cells. By using magnetic active cell sorting (MACS), we isolated a population of CD44(+)/CD133(+) prostate cancer cells that display stem cell characteristics from PC3 cell line. Immunohistochemistry revealed positive expressions of CD44, CD133 and α(2)β(1)-integin in the isolated cells. CCK-8 analysis showed that isolated cells had a strong proliferative ability. The formation of the cell spheres in serum-free medium and holoclones in serum-supplied medium showed that the cells were capable of self-renewing, indicating that the isolated cells were a population of cancer stem-like cells derived from PC3 cell line. Western blotting exhibited that the isolated cells had higher experession of Nanog, an embryonic stem marker, as compared with PC3 cells. Our study showed that Nanog might be helpful in sustaining the self-renewal and the undifferentiation of prostate cancer stem cells, and may serve as a marker for prostate cancer stem cells for isolation and identification.

Objective To investigate the efficacy and the mechanism of different dose hepatitis B immunoglohulin(HBIG)on prevention of HBV intrauterine infection and HBV S gene mutation. Methods HBV carrier mothers were randomly divided into three groups.Eighty-one HBsAg carrier pregnant women were divided into HBIG A group.HBIG B group and control group.Each subject in the HBIG A group received 200 U or 400 U(for HBsAg and HBeAg double positive carrier)intra muscularly at 3,2,1 month before delivery.Each subject in the HBIG B group received 200 U intra muscularly at 3,2,1 month before delivery.The subjects in the control group did not receive any treatment.Maternal blood samples were taken before HBIG injection and at delivery.Neonatal blood samples of all newborn infants after birth were taken before immunopropbylaxis.Their sera were ob tained to test HBV markers by enzyme immunoassay(EIA)and HBV DNA by fluorescence quantita- tive polymerase chain reaction(FQ-PCR),then to amplify and sequence HBV S gene region.Results The rate of HBV intrauterine infection in the HBIG group(14.5%)was lower than that in the control group(35.7%)(X~2=4.896,P=0.027).The rate of HBV intrauterine infection of newborns from HBsAg and HBeAg double positive carrier mother in the HBIG A group(37.5%)were lower than control group(100.0%)(X~2=7.273,P=0.007),while the rate was no different in the HBIG B group(71.5%)and the control group(X~2=2.637,P=0.104).Maternal HBsAg titer and HBV DNA level were of no difference among three groups before HBIG injection.Maternal HBsAg titers and HBV DNA levels of the HBIG A group were lower than those of the HBIG B group and the con- trol group at delivery.Among the 26 neonatal serum samples in the HBIG A group,10(38.5%)were positive for anti-HBs,while in the HBIG B group and in the control group,no neonatal serum sam- ples was positive.There was no significant difference of nucleotide and amino acid changes in the S gene between the HBIG group and the control group.Conclusions HBV infection in the uterus may be interrupted by injection HBIG intramuscularly before delivery.More efficacy would be found using variable HBIG dose according to different HBV virema and must be once more again injected just he- fore one week of delivery;anti-HBs transported to the fetus via the placenta and it's may be the im- portant mechanism of HBIG prevention.Asymptomatic HBsAg carrier mother received injections of HBIG before delivery should not influence HBV S gene mutation.Gene mutation of HBV is not the main factor in intrauterine transmission of HBV.

Object To study the chemical constituents of cytotoxicity portion in the bark of Reevesia longipetiolata Merr et Chun Methods The constituents were isolated and purified by various chromatographic methods, such as gel column chromatography under normal pressure and increased pressure, Sephadex LH 20 column chromatography and HPLC, and the structures were identified by physicochemical properties and spectral analysis Results Five compounds were obtained in the ethyl acetate fractions and identified as ? sitosterol (Ⅰ), daucosterol (Ⅱ), betulinic acid (Ⅲ), lupeol (Ⅳ) and (+) catechin (Ⅴ) Conclusion All above compounds are obtained from the plants of Reevesia Lindl for the first time, and their cytotoxicity is discussed

As a kind of additive in feed of monogastric animals, the application of natural phytase is limited due to its disadvantages. In this paper, the strategies of phytse reform was introduced. Furthermore, the research and progress on protein engineering of feed phytase was reviewed, including phytase over-expression, phytase thermostability, catalytic efficiency and optimum pH.

Objective To evaluate the effect of electro-acupuncture pretreatment on endoplasmic reticulum stress during global cerebral ischemia-reperfusion (I/R ) in rats .Methods One hundred and forty-four adult male Sprague-Dawley rats ,weighing 400-500 g ,were randomly divided into 3 groups ( n=48 each) using a random number table:sham operation group (group S ) , I/R group and electro-acupuncture pretreatment group (group EA) .Global cerebral I/R was induced by 4-vessel occlusion method .Bilateral vertebral arteries were permanently occluded by cauterization and bilateral carotid arteries were occluded for 5 min , followed by reperfusion .Electro-acupuncture of Dazhui and Baihui acupoints lasting for 30 min was performed once a day for 5 consecutive days starting from 5 days before ischemia in group EA .At 6 ,12 ,24 and 48 h of reperfusion ,12 rats were sacrificed in each group and hippocampi were removed for microscopic examination and for determination of apoptosis rate (by TUNEL ) and expression of growth arrest-and DNA damage-inducible gene 153 (GADD153 ) protein (by Western blot ) .Results Compared with group S ,the apoptosis rate was significantly increased and the expression of GADD153 protein was up-regulated at 6 ,12 ,24 and 48 h of reperfusion in I/R and EA groups ( P<0.05) .Compared with group I/R ,the apoptosis rate was significantly decreased and the expression of GADD 153 protein was down-regulated at 6 ,12 ,24 and 48 h of reperfusion in group EA ( P< 0.05) .The pathological changes were significantly attenuated in group EA as compared with group I/R .Conclusion Electro-acupuncture pretreatment can down-regulate the expression of GADD 153 protein , reduce endoplasmic reticulum stress , and decrease cell apoptosis ,thus attenuating global cerebral I/R injury in rats .