1.Association between health belief and medication adherence in hypertensive patients
Yue ZHAO ; Weilin QI ; Bin WANG
Chinese Journal of General Practitioners 2015;14(4):261-265
Objectives To investigate the association between health belief and medication adherence in hypertensive patients.Methods A total of 232 hypertensive patients who visited Outpatient Department of Huashan Hospital between October 2013 and May 2014 were recruited in this cross-section study.The degree of medication adherence was measured with Morisky scale and health belief was evaluated with questionnaires of Health Belief Model (HBM).Results Of the 232 participants,61 (26.3%),51 (22.0%) and 120 (51.7%) showed low,medium and high medication adherence in Morisky scale,respectively.Logistic analysis showed that the perceived susceptibility (P < 0.001),and cues to action (P =0.004) were positively correlated,and perceived barriers (P < 0.001) was negatively correlated with medication adherence of patients.Conclusion Effective interventions to improve antihypertensive medication adherence should increase perceived susceptibility,cues to action,and reduce the barriers to medication adherence of patients.
2.Diagnostic Value of ~(99m)Tc-Dimecraptosuccinate Acid Renal Cortical Scintigraphy for Urinary Tract Infection in Children
ling, WANG ; qi, ZHANG ; huan-bin, LI
Journal of Applied Clinical Pediatrics 2006;0(20):-
Objective To evaluate the diagnostic value of 99mTc-dimercaptosuccinate acid(DMSA) renal cortical scintigraphy for the identification of distinguishing between upper urinary infection(UUTI) and lower upper urinary infection(LUTI).Methods Two hundred and seventy-five children (111 males,164 females)ranging from 44 days to 15 years old,presented with urinary tract infection underwent 99mTc-DMSA renal cortical scintigraphy.The images were scored as normal (indicating LUTI) and abnormal (indicating acute pyelonephritis or renal scarring).Results Of 275 children with UTI,95 cases had normal images diagnosed as LUTI,41 males,54 females;and 180 cases had abnormal images,70 males,110 females.One hundred and seventy-four cases were diagnosed as acute pyelonephritis,6 cases were diagnosed as renal cortical scars,56 cases were single renal involved and 118 cases were both renal involved,and 22 cases repeatedly underwent renal cortical scanning after therapy.Sixteen of 18 cases with acute pyelonephritis completely recovered normal or obviously ameliorated after 0.5 to 2.0 years,2 cases did not show any improvement after 0.5 to 1.5 years,4 cases with renal scarring,and showed little change on repeated images after 1.0 to 1.5 years.Conclusions The 99mTc-DMSA renal scintigraphy is very useful in differentiating the children with urinary tract infection.It also can be used to determine the extension,degree and nature of UUTI,and might play an important role in the treatment and follow-up observation in children with UUTI.
3.Retrospective analysis between the difficult airway and thyromental height by three-dimensional reconstruction
Yun YANG ; Xiaohai WANG ; Xingshuang WANG ; Qi TONG ; Bin ZHU
Chinese Journal of Postgraduates of Medicine 2016;39(3):209-212
Objective To analyze retrospectively the correlation between the difficult airway and thyromental height by three-dimensional reconstruction among the Chinese. Methods Eithty patients who had been scanned by helical CT in the head and neck were allocated into two groups according to Cormack-Lehane grading:paients with Ⅰ-Ⅱ grade were allocated into group 1, and paients with Ⅲgrade were allocated into group 2. Reconstructed images were obtained by AW4.4 workstation and the following parameters were recorded and analyzed:the length from the oral to the under jaw(a), the length from the under jaw to the skin of the neck (b), the vertical distance from the under jaw to the neck was equal to thyromental height(c), the vertical distance from the oral to the cervical vertebra(d), the angle with the under jaw as the vertices and with two lines (a and b) for edge (angle ofα). Results The c value in two groups had no significant difference:(3.97 ± 0.82) cm vs. (3.64 ± 0.62) cm, P>0.05. The d value in group 2 was significantly higher than that in group 1:(8.69 ± 0.48) cm vs. (8.25 ± 0.80) cm, P<0.05. The c/d value and c/a value in group 2 were significantly lower than those in group 1: 0.42 ± 0.07 vs. 0.48 ± 0.12, 0.80 ± 0.18 vs. 0.95 ± 0.25, P<0.05. Conclusions Thyromental height by three-dimensional reconstruction has no significant differences in evaluating the difficult airway among the Chinese. The ratio of the vertical distance from the under jaw to the neck and the vertical distance from the oral to the cervical vertebra, and the ratio of the vertical distance from the under jaw to the neck and the length from the oral to the under jaw shows negative correlation with difficult airway.
4.Analysis of sagittal anatomic structure of upper airway in patients with ankylosing spondylitis: computed tomography-based three-dimensional reconstruction
Xingshuang WANG ; Xiaohai WANG ; Wenyuan LI ; Qi TONG ; Bin ZHU
Chinese Journal of Anesthesiology 2013;33(9):1096-1098
Objective To investigate the characteristics of sagittal anatomic structure of the upper airway in patients with ankylosing spondylitis using three-dimensional reconstruction based on computed tomography (CT).Methods Thirty-one male patients with ankylosing spondylitis,aged 20-60 yr (AS group),and 41 common patients (male) without difficult airways,aged 20-60 yr (control group),who underwent spiral CT scan of the head and neck using Helical CT from January 2007 to February 2011 in our hospital,were enrolled in the study.Reconstructed images of the upper airway were obtained using AW4.4 workstation and six distances (D1-D6) and four angles (α-δ) were recorded and analyzed:(1)D1,the arc distance between the upper central incisor and root of epiglottis; D2,the distance between the upper central incisor and root of epiglottis; D3 and D4,the lengths of maxilla and mandible ; D5,the distance between the root of epiglottis and midpoint of glottis; D6,the distance between the end of mandible and midpoint of glottis; (2) angle α,the angle of line D2 and D5; angle β,the angle of line D2 and the lower edge of the upper central incisor to the midpoint of glottis; angle γ,the angle of line D4 and D6; angle δ,the angle of the point of the lower edge of the upper central incisor to the trailing edge of the hard palate and then to the root of epiglottis.Results Compared with control group,no significant change was found in D1,D2,D3,D4 and D5 (P > 0.05),and D6,angle α and angle δ were significantly increased,whereas angle β and angle γ were decreased in AS group (P < 0.05).Conclusion The anatomic structure of the upper airway has the characteristics of specific changes and a laryngoscope blade with a large degree of curvature may be helpful for successful tracheal intubation in patients with ankylosing spondylitis.
5.Intense pulsed light and red light emitting diode for the treatment of steroid-dependent dermatitis
Jing WANG ; Bin LIU ; Qi LUAN ; Yanting WANG ; Chengxin LI
Chinese Journal of Dermatology 2012;45(3):205-207
Objective To retrospectively review the efficacy and side effects of intense pulsed light (IPL) and red light emitting diode (LED) in the treatment of steroid-dependent dermatitis.Methods Seventy patients with steroid-dependent dermatitis mainly manifesting as facial telangiectasis were treated with IPL for an average of 3.49 sessions with a 4-week interval.The energy density of IPL varied from 20 to 23 J/cm2,pulse width from 2.6 to 5.0 ms,and delay from 15 to 20 ms.Meantime,197 patients with steroid-dependent dermatitis,who mainly presented with facial skin sensitivity,were treated with red LED (633 ± 3 nm wave length) twice a week for an average of 4.23 sessions.The energy density of red LED was 128 J/cm2,and the irradiation lasted 20 minutes at each treatment.The efficacy and adverse reactions were assessed and recorded for each treatment.Results The total response rate was 88.57% for IPL,and 83.76% for red LED.There was a significant difference in the clinical efficacy between triple-pulse and double-pulse IPL (x2 =8.14,P < 0.05).No severe adverse reaction was observed in any of the patients.Conclusion IPL and red LED are both effective in treating steroid-dependent dermatitis.
6.Rat ?-defensin rBD-1 gene expresses constitutively in skin and kidney
Ning HUANG ; Qi WU ; Bin TANG ; Xinnian CHENG ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(01):-
AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.
7.The application and research of project management in the construction of information collection system of TCM clinics
Yang LIU ; Baoyan LIU ; Qi XIE ; Huaxin SHI ; Bin WANG
International Journal of Traditional Chinese Medicine 2014;(11):961-964
This paper briefly introduces the research background, combined with the practical of project, analysis the feature of the construction of information collection system of TCM clinics, and puts forward how to use the method of project management in the construction of information collection system of TCM clinics. By exploring the Project Phasing, Work Breakdown Structure, Project Responsibility Matrix, and Project management standard system, it hopes to strengthen the awareness of project management in the construction of information collection system of TCM clinics, and to guide the project management and the system construction.
8.A modified Sugiura procedure for variceal bleeding
Qi WANG ; Feilong LIU ; Zhiwei ZHANG ; Bin MEI
Chinese Journal of General Surgery 2015;30(2):104-107
Objective To evaluate a modified Suguira procedure for the treatment of variceal bleeding.Methods A modified Suguira procedure was performed in 62 patients with acute variceal bleeding (11 cases) that could not be controlled by endoscopic therapy or with a history of massive bleeding (51 cases) after endoscopic therapy.Results Perioperative mortality occurred in 2% (1/62) patients.Esophageal anastomotic leak occurred in 2% (1/62) patients,and anastomotic stenosis developed in 5% (3/62) patients.Twelve months after operation,esophageal varices disappeared in 79% (48/61) patients,diminished in size in 18% (11/61),remained unchanged in 3% (2/61) ; Fundal gastric varices disappeared in 98% (60/61) patients,diminished in size in 2% (1/62).The rebleeding rate was 3% (2/61) and 8% (5/61) in 3 years and 5 years,respectively.Conclusions The modified Suguira procedure is safe and effective for long-term control of variceal bleeding after a failed endoscopic therapy.
9.The application of looping technique by using a gooseneck snare and a loach guide wire in retrieving foreign bodies within the vascular or ureteral duct
Bin XIONG ; Chuansheng ZHENG ; Qi WANG ; Ming LIANG ; Jun ZENG
Journal of Interventional Radiology 2014;(7):630-633
Objective To investigate the feasibility and application scope of the looping technique by using a gooseneck snare and a loach guide wire in retrieving tubular foreign bodies within the vascular or ureteral duct. Methods During the period from July 2009 to Dec. 2013, six patients with ruptured catheter were admitted to authors’ hospital. All six patients were females. Three patients had internal ruptured peripherally inserted central venous catheter (PICC), one patient had ruptured implantable venous access port catheter and two patients had replacement of double “J” ureteral catheter stent. By using looping technique, i.e. a loach guide wire and a gooseneck snare were separately placed at the two ends of the tubular foreign body, then the gooseneck snare entangled the soft leading end of the loach guide wire to form a annular structure to seize the ruptured tubular catheter and then to pull it out of the body. Results With the help of the looping technique, the internal ruptured catheter or the double “J” ureteral catheter was successfully removed in all the six patients. Conclusion For the retrieval of the tubular foreign bodies within the vascular or ureteral duct, the looping technique by using a gooseneck snare and a loach guide wire is an effective and fast treatment. Therefore, this technique should be recommended in the clinical practice.
10.Effects of Bone Marrow Mesenchymal Stem Cells Transplantation on Expression of Growth Associated Protein-43 in Rats after Spinal Cord Injury
Bingkui LI ; Bin ZENG ; Wei CHANG ; Dayi WANG ; Qi YANG
Chinese Journal of Rehabilitation Theory and Practice 2015;(12):1391-1396
Objective To observe the effect of bone marrow mesenchymal stem cells (BMSCs) transplantation on the expression of growth associated protein-43 (GAP-43) in rats after spinal cord injury (SCI). Methods The SCI models were made by impacting at the level of T11 segment. After modeling, the rats were randomly and equally divided into control group (n=18) and observation group (n=18). 1 week after injury, DMEM/F12 medium 0.1 ml was injected into tail vein of rats in the control group, and an equal volume of BMSCs suspension was injected in the observation group. 1, 2, 4, 8 weeks after SCI, the hindlimb function was evaluated by the Basso-Beattie-Bresnahan (BBB) score. 2, 4, 8 weeks after SCI, the expression of GAP-43 mRNA was detected by RT-PCR, and the expression of GAP-43 was detect-ed by the immunohistochemistry. Results 2, 4, 8 weeks after SCI, compared with the control group, The BBB score increased, the expres-sion of GAP-43 mRNA and GAP-43 increased in the observation group (P<0.05). Conclusion BMSCs transplantation can improve the ex-pression of GAP-43 in gene and protein level, and then promote the repair of SCI.