Acupuncture Points ; Adult ; Electroacupuncture ; Fatty Liver ; therapy ; Female ; Humans ; Male ; Middle Aged ; Non-alcoholic Fatty Liver Disease

BACKGROUND:How to avoid denervated muscular atrophy is a key factor to improve the therapeutic efficacy on peripheral nerve injuries. OBJECTIVE:To study the effect of basic fibroblast growth factor (bFGF) gene-transfected bone marrow mesenchymal stem cels against denervated muscle atrophy. METHODS: bFGF genes were transfected into rat bone marrow mesenchymal stem cels using viral transfection method, and then MTT, immunohistochemical staining, hematoxylin-eosin staining, RT-PCR, western blot, and ELISA methods were used to detect the transfection efficiency and product expression. Thirty-two Sprague-Dawley rats were selected to make animal models of sciatic nerve injury, and subjected to multi-point intramuscular injection of bFGF-transfected bone marrow mesenchymal stem cels (experimental group) or cel culture fluid (control group). At 2, 4, 6, 8 weeks after transfection, the gastrocnemius muscle tissues were harvested to detect action potential, residual wet weight, and cross-sectional area of muscle fibers. RESULTS AND CONCLUSION:The bFGF gene was successfuly transfected into bone marrow mesenchymal stem cels using the viral transfection method. The residual wet weight, cross-sectional area and residual action potential of the gastrocnemius muscle were significantly better in the experimental group than the control group (P < 0.05). These findings indicate that bFGF gene-transfected bone marrow mesenchymal stem cels transplanted into the denervated muscle can retard the development of muscle atrophy. Cite this article:Yu N, Wang YS, Qi CP.Application of basic fibroblast growth factor gene-transfected bone marrow mesenchymal stem cels in denervated muscle atrophy. Zhongguo Zuzhi Gongcheng Yanjiu. 2016;20(1):89-94.

Toll signaling pathway may play a curcial role in induction of inflammation-associated gene activation. Originally, the Toll/spaetzle/Cactus-Dorsal signaling pathway is established in the Drosophila embryonic development. Recently, the Toll signaling pathway in adult Drosophila has been established in the induction of antimicrobial peptide expression. Five human Toll-like receptor genes (h Tlr l-5 ) and one mouse Toll-like receptor gene (m Tlr-4 ) have been isolated. Toll and Toll-like receptor genes encoded molecules are transmembrane proteins with an extracellular leucine repeat domain and a cytoplasmic domain homologous to IL-1 receptors. The intracellular signaling cascade involves Tube, Pelle, and Cactus-Dorsal complex in Drosophila, and MyD88, IRAK, TRAF 6, NIK, ??-I ?B kinase, and I ?B -NF?B complex in mammals. Dorsal and NF?B are transcription factors, while Cactus and I?B are their inhibitors. When the inhibitors phosphorylated, the nuclear factors are released and move into nucleus, leading to immune gene activation. It has been shown from in vitro system that Tlr -4 mediated LPS signaling in human monocytes for expression of IL-1, IL-6, IL-8, and costimulator B7-1 which provides second signal for T cell response. Tlr -2 can also mediate LPS signaling in human monocytes, leading to the production of proinflammatory mediators. Microbial lipoproteins are potent stimulators of IL-12 production through Tlr -2 signaling by human macrophages, and can stimulate Tlr 2-dependent transcription of inducible nitric oxide synthase and the production of nitric oxide, a powerful microbicidal pathway. Findings of a point mutation of Tlr-4 in LPS tolerant C3H/HeJ mouse strain and a deletion of Tlr-4 in LPS resistant C57BL/10ScCr mice provide an in vivo evidence strongly supporting the crucial role of Tlrs in LPS mediated inflammation. It is proposed that targeting Tlrs would develop new remedies for treatment of inflammatory disorders and for immunotherapy of mucosal infections and cancer, etc.

Objective To probe the changes of CT values in liver parenchyma in order to evaluate the therapeutic effect of acute pancreatitis.Methods 104 patients with acute pancreatitis which were diagnosed and treated by department of gastroenterology.Ac-cording to pathological results,the patients were divided into mild acute pancreatitis (MAP)group and severe acute pancreatitis (SAP)one.The CT values of liver parenchyma were measured before and after treatment,and the correlations between CT values changes and the amylase in blood and urine were analyzed.Results The CT values of liver parenchyma showed a negative correlation with the pathological severity of acute pancreatitis (r=-0.089,P <0.05).The accuracy using the changes of CT values to evaluate the therapeutic effect was significantly different between the MAP and the SAP group with different sensitivity of 92.2% and 85.7%and specificity of 33.3% and 94.1% respectively.In addition,the changed trend of CT values in liver parenchyma showed negative correlations with triglycerides and blood amylase.Conclusion CT scan is a useful imaging method in evaluating the liver damage and the therapeutic effect in patients with acute pancreatitis in emergency.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Adolescent ; Female ; Humans ; Patellar Dislocation ; physiopathology ; surgery ; Patellar Ligament ; injuries ; physiopathology ; surgery ; Range of Motion, Articular ; Reconstructive Surgical Procedures

Acute Coronary Syndrome ; Humans

Arthritis, Juvenile ; diagnosis ; pathology ; Biomarkers, Tumor ; blood ; Biopsy ; Bone Neoplasms ; diagnosis ; pathology ; Child, Preschool ; Diagnostic Errors ; Female ; Hip Joint ; diagnostic imaging ; pathology ; Humans ; Ilium ; diagnostic imaging ; pathology ; Magnetic Resonance Imaging ; Radiography ; Sarcoma, Ewing ; diagnosis ; pathology

Objective: To evaluate the efficacy and safety of acupuncture for the treatment of knee osteoarthritis and to provide evidence for its use in clinical practice. Methods: Eight databases were extensively searched up to March 2018. Randomized controlled trials (RCTs) comparing the efficacy of acupuncture with sham acupuncture or no acupuncture for knee osteoarthritis were included. Study selection, data extraction and quality assessment were independently conducted by two reviewers. The Cochrane Collaboration's tool was used for assessing the risk of bias. Results: A total of 18 RCTs were included, involving a total of 3522 participants. The results showed that acupuncture was superior to sham acupuncture in relieving pain (SMD=-0.34, 95％CI:-0.57 to -0.11, I2=85％, P=0.003) and improving physical function (SMD=-0.34, 95％CI: -0.57 to -0.11, I2=85％, P=0.003). In comparison to the no-acupuncture group, the acupuncture group also showed significant advantages in relieving pain (SMD=-0.79, 95％CI: -1.15 to -0.43, I2=87％, P<0.0001) and improving physical function (SMD=-0.75, 95％CI:-1.19 to -0.31, I2=91％, P=0.0008). Sensitivity analyses suggested that the results were robust, and Egger's test found no potential publication bias. Conclusion: In the treatment of knee osteoarthritis, the acupuncture group had significant advantages over sham acupuncture or no-acupuncture groups in relieving pain and improving physical function.

Based on new material and technic, the design of general structure, stretcher fixture, vibration isolation, carriage baffle fixture, ergonomical parameters selection for a new kind of stretcher suspension named added equipment for transporting the wounded on the truck is carried out. The results of mechanical performance experiment, reliability experiment, road adaptability test, road comfort test, application experiment by troops indicate that the added equipment is safe, reliable, convenient for use and fairly comfortable to persons lying on it. Thus a new kind of equipment fit for the army to transport the wounded on the truck under the field condition is developed.