2.Application of basic fibroblast growth factor gene-transfected bone marrow mesenchymal stem cells in denervated muscle atrophy
Ning YU ; Yansheng WANG ; Changping QI
Chinese Journal of Tissue Engineering Research 2016;20(1):89-94
BACKGROUND:How to avoid denervated muscular atrophy is a key factor to improve the therapeutic efficacy on peripheral nerve injuries. OBJECTIVE:To study the effect of basic fibroblast growth factor (bFGF) gene-transfected bone marrow mesenchymal stem cels against denervated muscle atrophy. METHODS: bFGF genes were transfected into rat bone marrow mesenchymal stem cels using viral transfection method, and then MTT, immunohistochemical staining, hematoxylin-eosin staining, RT-PCR, western blot, and ELISA methods were used to detect the transfection efficiency and product expression. Thirty-two Sprague-Dawley rats were selected to make animal models of sciatic nerve injury, and subjected to multi-point intramuscular injection of bFGF-transfected bone marrow mesenchymal stem cels (experimental group) or cel culture fluid (control group). At 2, 4, 6, 8 weeks after transfection, the gastrocnemius muscle tissues were harvested to detect action potential, residual wet weight, and cross-sectional area of muscle fibers. RESULTS AND CONCLUSION:The bFGF gene was successfuly transfected into bone marrow mesenchymal stem cels using the viral transfection method. The residual wet weight, cross-sectional area and residual action potential of the gastrocnemius muscle were significantly better in the experimental group than the control group (P < 0.05). These findings indicate that bFGF gene-transfected bone marrow mesenchymal stem cels transplanted into the denervated muscle can retard the development of muscle atrophy. Cite this article:Yu N, Wang YS, Qi CP.Application of basic fibroblast growth factor gene-transfected bone marrow mesenchymal stem cels in denervated muscle atrophy. Zhongguo Zuzhi Gongcheng Yanjiu. 2016;20(1):89-94.
3.Toll receptor signaling pathway in inflammation
Boyao WANG ; Ning HUANG ; Qi WU
Chinese Journal of Pathophysiology 1989;0(06):-
Toll signaling pathway may play a curcial role in induction of inflammation-associated gene activation. Originally, the Toll/spaetzle/Cactus-Dorsal signaling pathway is established in the Drosophila embryonic development. Recently, the Toll signaling pathway in adult Drosophila has been established in the induction of antimicrobial peptide expression. Five human Toll-like receptor genes (h Tlr l-5 ) and one mouse Toll-like receptor gene (m Tlr-4 ) have been isolated. Toll and Toll-like receptor genes encoded molecules are transmembrane proteins with an extracellular leucine repeat domain and a cytoplasmic domain homologous to IL-1 receptors. The intracellular signaling cascade involves Tube, Pelle, and Cactus-Dorsal complex in Drosophila, and MyD88, IRAK, TRAF 6, NIK, ??-I ?B kinase, and I ?B -NF?B complex in mammals. Dorsal and NF?B are transcription factors, while Cactus and I?B are their inhibitors. When the inhibitors phosphorylated, the nuclear factors are released and move into nucleus, leading to immune gene activation. It has been shown from in vitro system that Tlr -4 mediated LPS signaling in human monocytes for expression of IL-1, IL-6, IL-8, and costimulator B7-1 which provides second signal for T cell response. Tlr -2 can also mediate LPS signaling in human monocytes, leading to the production of proinflammatory mediators. Microbial lipoproteins are potent stimulators of IL-12 production through Tlr -2 signaling by human macrophages, and can stimulate Tlr 2-dependent transcription of inducible nitric oxide synthase and the production of nitric oxide, a powerful microbicidal pathway. Findings of a point mutation of Tlr-4 in LPS tolerant C3H/HeJ mouse strain and a deletion of Tlr-4 in LPS resistant C57BL/10ScCr mice provide an in vivo evidence strongly supporting the crucial role of Tlrs in LPS mediated inflammation. It is proposed that targeting Tlrs would develop new remedies for treatment of inflammatory disorders and for immunotherapy of mucosal infections and cancer, etc.
4.The changes of CT values in liver parenchyma and its pathogenesis after treatment of acute pancreatitis
Wu NING ; Yongqian QIANG ; Xianning LI ; Hui NING ; Xiaojiang QI ; Qianjin SHAN ; Ning WANG
Journal of Practical Radiology 2015;(4):596-599,629
Objective To probe the changes of CT values in liver parenchyma in order to evaluate the therapeutic effect of acute pancreatitis.Methods 104 patients with acute pancreatitis which were diagnosed and treated by department of gastroenterology.Ac-cording to pathological results,the patients were divided into mild acute pancreatitis (MAP)group and severe acute pancreatitis (SAP)one.The CT values of liver parenchyma were measured before and after treatment,and the correlations between CT values changes and the amylase in blood and urine were analyzed.Results The CT values of liver parenchyma showed a negative correlation with the pathological severity of acute pancreatitis (r=-0.089,P <0.05).The accuracy using the changes of CT values to evaluate the therapeutic effect was significantly different between the MAP and the SAP group with different sensitivity of 92.2% and 85.7%and specificity of 33.3% and 94.1% respectively.In addition,the changed trend of CT values in liver parenchyma showed negative correlations with triglycerides and blood amylase.Conclusion CT scan is a useful imaging method in evaluating the liver damage and the therapeutic effect in patients with acute pancreatitis in emergency.
6.Research update on Kounis syndrome.
Chinese Journal of Cardiology 2013;41(6):527-529
7.Study of β-defensin rBD-2 gene expression in the pulmonary tissues of the fetal, neonatal and adult rats
Hui ZHOU ; Ning HUANG ; Xinnian CHEN ; Qi WU ; Boyao WANG
Chinese Journal of Pathophysiology 2001;17(3):226-229
AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.
8.Effect of Fukeqianjin tablets on uterine bleeding patients serum immunoglobulin IgM, IgA, IL-2 in serum and its soluble receptor function
Chunyue WANG ; Ning LI ; Xinya XU ; Qi YE
Chinese Journal of Biochemical Pharmaceutics 2017;37(4):72-74
Objective To investigate the effect of Fukeqianjin tablets combined with progesterone on serum immunoglobulin,serum IL-2 and soluble receptor levels in patients with functional uterine bleeding,and to explore the optimal regimen for patients with functional uterine bleeding.Methods A total of 98 patients with functional uterine bleeding diagnosed in our hospital from June,2015 to June,2016 were randomLy divided into observation group and control group(n=49).The patients in the control group were treated with oral progesterone and the observation group.The control group was treated on the basis of the combination of gynecological Qianjin Tablet,compared the two groups of patients before and after treatment of menstrual conditions,serum IgM,IgA,serum IL-2 and soluble receptor levels.Results In the first month,the second month and the third month after treatment,the menstrual volume in the observation group were(103.5±21.5)mL,(93.5±14.7)mL,(81.4± 12.2)(7.68±0.92)d,(6.81±0.87)d and(6.14±0.78)d respectively in the observation group were significantly shorter than those in the control group(P<0.05).After treatment,the menstrual period The serum levels of IgA and IgM were(3.6±0.8),(2.6±0.8),(1.8±0.3)and(2.9±0.5),(2.2±0.3),(1.1±0.2)in the first month,the second month and the third month respectively,Significantly lower than the control group,the difference was statistically significant; the first month after treatment,the first two months,the first three months,observation group of patients with serum IL-2 and soluble receptor levels significantly Lower than the control group.Conclusion Fukeqianjin tablets combined with progesterone can improve the immune function of patients with functional uterine bleeding,reduce the level of inflammation and soluble receptor levels,compared with single progesterone treatment better,the program better.
9.Rat ?-defensin rBD-1 gene expresses constitutively in skin and kidney
Ning HUANG ; Qi WU ; Bin TANG ; Xinnian CHENG ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(01):-
AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.
10.Study of ?-defensin rBD-2 gene expression in the pulmonary tissues of the fetal, neonatal and adult rats
Hui ZHOU ; Ning HUANG ; Xinnian CHEN ; Qi WU ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(03):-
AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.