Acupuncture Points ; Adult ; Electroacupuncture ; Fatty Liver ; therapy ; Female ; Humans ; Male ; Middle Aged ; Non-alcoholic Fatty Liver Disease

Toll signaling pathway may play a curcial role in induction of inflammation-associated gene activation. Originally, the Toll/spaetzle/Cactus-Dorsal signaling pathway is established in the Drosophila embryonic development. Recently, the Toll signaling pathway in adult Drosophila has been established in the induction of antimicrobial peptide expression. Five human Toll-like receptor genes (h Tlr l-5 ) and one mouse Toll-like receptor gene (m Tlr-4 ) have been isolated. Toll and Toll-like receptor genes encoded molecules are transmembrane proteins with an extracellular leucine repeat domain and a cytoplasmic domain homologous to IL-1 receptors. The intracellular signaling cascade involves Tube, Pelle, and Cactus-Dorsal complex in Drosophila, and MyD88, IRAK, TRAF 6, NIK, ??-I ?B kinase, and I ?B -NF?B complex in mammals. Dorsal and NF?B are transcription factors, while Cactus and I?B are their inhibitors. When the inhibitors phosphorylated, the nuclear factors are released and move into nucleus, leading to immune gene activation. It has been shown from in vitro system that Tlr -4 mediated LPS signaling in human monocytes for expression of IL-1, IL-6, IL-8, and costimulator B7-1 which provides second signal for T cell response. Tlr -2 can also mediate LPS signaling in human monocytes, leading to the production of proinflammatory mediators. Microbial lipoproteins are potent stimulators of IL-12 production through Tlr -2 signaling by human macrophages, and can stimulate Tlr 2-dependent transcription of inducible nitric oxide synthase and the production of nitric oxide, a powerful microbicidal pathway. Findings of a point mutation of Tlr-4 in LPS tolerant C3H/HeJ mouse strain and a deletion of Tlr-4 in LPS resistant C57BL/10ScCr mice provide an in vivo evidence strongly supporting the crucial role of Tlrs in LPS mediated inflammation. It is proposed that targeting Tlrs would develop new remedies for treatment of inflammatory disorders and for immunotherapy of mucosal infections and cancer, etc.

BACKGROUND:How to avoid denervated muscular atrophy is a key factor to improve the therapeutic efficacy on peripheral nerve injuries. OBJECTIVE:To study the effect of basic fibroblast growth factor (bFGF) gene-transfected bone marrow mesenchymal stem cels against denervated muscle atrophy. METHODS: bFGF genes were transfected into rat bone marrow mesenchymal stem cels using viral transfection method, and then MTT, immunohistochemical staining, hematoxylin-eosin staining, RT-PCR, western blot, and ELISA methods were used to detect the transfection efficiency and product expression. Thirty-two Sprague-Dawley rats were selected to make animal models of sciatic nerve injury, and subjected to multi-point intramuscular injection of bFGF-transfected bone marrow mesenchymal stem cels (experimental group) or cel culture fluid (control group). At 2, 4, 6, 8 weeks after transfection, the gastrocnemius muscle tissues were harvested to detect action potential, residual wet weight, and cross-sectional area of muscle fibers. RESULTS AND CONCLUSION:The bFGF gene was successfuly transfected into bone marrow mesenchymal stem cels using the viral transfection method. The residual wet weight, cross-sectional area and residual action potential of the gastrocnemius muscle were significantly better in the experimental group than the control group (P < 0.05). These findings indicate that bFGF gene-transfected bone marrow mesenchymal stem cels transplanted into the denervated muscle can retard the development of muscle atrophy. Cite this article:Yu N, Wang YS, Qi CP.Application of basic fibroblast growth factor gene-transfected bone marrow mesenchymal stem cels in denervated muscle atrophy. Zhongguo Zuzhi Gongcheng Yanjiu. 2016;20(1):89-94.

Objective To probe the changes of CT values in liver parenchyma in order to evaluate the therapeutic effect of acute pancreatitis.Methods 104 patients with acute pancreatitis which were diagnosed and treated by department of gastroenterology.Ac-cording to pathological results,the patients were divided into mild acute pancreatitis (MAP)group and severe acute pancreatitis (SAP)one.The CT values of liver parenchyma were measured before and after treatment,and the correlations between CT values changes and the amylase in blood and urine were analyzed.Results The CT values of liver parenchyma showed a negative correlation with the pathological severity of acute pancreatitis (r=-0.089,P <0.05).The accuracy using the changes of CT values to evaluate the therapeutic effect was significantly different between the MAP and the SAP group with different sensitivity of 92.2% and 85.7%and specificity of 33.3% and 94.1% respectively.In addition,the changed trend of CT values in liver parenchyma showed negative correlations with triglycerides and blood amylase.Conclusion CT scan is a useful imaging method in evaluating the liver damage and the therapeutic effect in patients with acute pancreatitis in emergency.

Arthritis, Juvenile ; diagnosis ; pathology ; Biomarkers, Tumor ; blood ; Biopsy ; Bone Neoplasms ; diagnosis ; pathology ; Child, Preschool ; Diagnostic Errors ; Female ; Hip Joint ; diagnostic imaging ; pathology ; Humans ; Ilium ; diagnostic imaging ; pathology ; Magnetic Resonance Imaging ; Radiography ; Sarcoma, Ewing ; diagnosis ; pathology

Adolescent ; Female ; Humans ; Patellar Dislocation ; physiopathology ; surgery ; Patellar Ligament ; injuries ; physiopathology ; surgery ; Range of Motion, Articular ; Reconstructive Surgical Procedures

Acute Coronary Syndrome ; Humans

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Objective The objectives of this study were to investigate the clinical significance of CD39,CD73,double positive subgroups for CD39 and CD73,and other lymphocytes with clinicopathological parameters in the microenvironment of colorectal cancer.Methods Tumor infiltrating lymphocyte(TIL)was collected from 24 patients with colorectal cancer after radical resection.The expression of CD39+,CD73+ or CD39+ with CD73+ in T cells were measured by flow cytometry.The association between these subgroups and clinicopathologic parameters was analyzed.Results The CD73+ and CD39+ with CD73+ subgroups were associated with lymph node metastasis and poor degree of differentiation,and this mechanism was closely related to tumor-associated inflammation.Conclusion CD39+ with CD73+ colorectal tumor infiltration Treg has a more unique biological activity than other Treg group.This study provides a new idea and theoretical basis for predicting the prognosis of colorectal cancer.

Based on new material and technic, the design of general structure, stretcher fixture, vibration isolation, carriage baffle fixture, ergonomical parameters selection for a new kind of stretcher suspension named added equipment for transporting the wounded on the truck is carried out. The results of mechanical performance experiment, reliability experiment, road adaptability test, road comfort test, application experiment by troops indicate that the added equipment is safe, reliable, convenient for use and fairly comfortable to persons lying on it. Thus a new kind of equipment fit for the army to transport the wounded on the truck under the field condition is developed.