AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThe U6 promoter is an essential element for driving sgRNA expression in the clustered regularly interspaced short palindromic repeat sequences/CRISPR-associated protein 9（CRISPR/Cas9）gene editing system in dicotyledonous plants. Endogenous U6 promoters typically exhibit higher transcriptional activity， which can significantly improve gene editing efficiency. This study aims to identify endogenous U6 promoters in Artemisia annua to optimize its CRISPR/Cas9 gene editing system， which holds significant importance for its molecular breeding. MethodsOn the basis of the highly conserved U6 snRNA sequences in Arabidopsis thaliana， endogenous U6 promoters were screened in the A. annua genome. Expression vectors were constructed with candidate AaU6 promoter driving the firefly luciferase （LUC） reporter gene， and then transiently transformed into Nicotiana benthamiana. Transcriptional activities of the promoters were measured and compared by in vivo imaging and the Dual Luciferase Reporter assay. ResultsEight endogenous U6 promoters were successfully cloned from A. annua. Sequences alignment revealed that all these promoters contained the two conserved cis-acting elements， upstream sequence element （USE） and TATA-box， which affected their transcriptional activity. Dual-luciferase activity assays indicated that the transcriptional activities of AaU6-3， AaU6-1， and AaU6-5 were significantly higher than that of the Arabidopsis AtU6-26 promoter， with AaU6-3 exhibiting the highest activity. ConclusionThis study identified three endogenous AaU6 promoters with high transcriptional activity in A. annua， providing key functional elements for establishing an efficient gene editing system in A. annua. These findings will contribute to advancing precision molecular breeding and high-quality germplasm innovation in A. annua.

Tumor metastasis is the leading cause of high mortality in most cancers, and numerous studies have demonstrated that the malignant crosstalk of multiple components in the tumor microenvironment (TME) together promotes tumor metastasis. Cancer-associated fibroblasts (CAFs) are the major stromal cells and crosstalk centers in the TME of various kinds of tumors, such as breast cancer, pancreatic cancer, and prostate cancer. Recently, the CAF-induced pro-tumor metastatic TME has gained wide attention, being considered as one of the effective targets for tumor therapy. With in-depth research, CAFs have been found to promote tumor metastasis through multiple mechanisms, such as inducing epithelial-mesenchymal transition in tumor cells, remodeling the extracellular matrix, protecting circulating tumor cells, and facilitating the formation of a pre-metastatic niche. To enhance the anti-tumor metastasis effect, therapeutic strategies designed by combining nano-drug delivery systems with CAF modulation are undoubtedly a desirable choice, as evidenced by the research over the past decades. Herein, we introduce the physiological properties of CAFs, detail the possible mechanisms whereby CAFs promote tumor metastasis, categorize CAFs-based nano-drug delivery strategies according to their anti-metastasis functions and discuss the current challenges, possible solutions, as well as the future directions in order to provide a theoretical basis and reference for the utilization of CAFs-based nano-drug delivery strategies to promote tumor metastasis therapy.

Single-cell analysis of phenotypic plasticity could improve the development of more effective therapeutics. Still, the development of tools to measure single-cell heterogeneity has lagged due to difficulties in manipulating and culturing single cells. Here, we describe a single-cell culture and phenotyping platform that employs a starburst microfluidic network and automatic liquid handling system to capture single cells for long-term culture and multi-dimensional analysis and quantify their clonal properties via their surface biomarker and secreted cytokine/growth factor profiles. Studies performed on this platform found that cells derived from single-cell cultures maintained phenotypic equilibria similar to their parental populations. Single-cell cultures exposed to chemotherapeutic drugs stochastically disrupted this balance to favor stem-like cells. They had enhanced expression of mRNAs and secreted factors associated with cell signaling, survival, and differentiation. This single-cell analysis approach can be extended to analyze more complex phenotypes and screen responses to therapeutic targets.

OBJECTIVE To obtain stronger cytotoxic activity of panaxadiol derivatives. METHODS The 3-amino panaxadiol was prepared by the bioelectronic isosteric principle, and then 18 derivatives of cinnamic acid, NO donor and other types of panaxadiol derivatives were synthesized, among them, 12 compounds had not been reported in the literature, and their structures had been confirmed by 1H-NMR, 13C-NMR and mass spectrometry. These compounds were evaluated for their cytotoxic activity by MTS assay against human leukemia cell line HL-60, liver cancer cell line SMMC-7721, lung cancer cell line A-549, breast cancer cell line MCF-7, and colon cancer cell line SW480. RESULTS These results showed that compounds 6c, 7 as well as 7j exhibited potent inhibitory activities against all five tumor cells, especially the IC50 values of compound 7 against HL-60 and SMMC-7721cells were 3.41 and 4.51 μmol·L−1, respectively. It was significantly superior to panaxadiol in cytotoxicity. CONCLUSION These results show that 7 and 7j can be used as promising lead compounds for further research.

Objective:To investigate the clinical characteristics and offer diagnostic and therapeutic approaches for adult-onset idiopathic hypogonadotropic hypogonadism(AIHH).Methods:Clinical, laboratory, and imaging data, as well as follow-up information, of three male patients diagnosed with AIHH at the Department of Endocrinology and Metabolism of Nanfang Hospital, Southern Medical University, were systematically reviewed and analyzed.Results:All three patients were male, with a median age of 39 years(range, 22 to 40). Two patients reported symptoms of enlarged breasts and reduced sexual function, while one case solely reported a decline in sexual function. Physical examination showed that the median length of the penis was 6 cm(range, 5 to 6 cm), and the bilateral testicular volume was 7.96 mL(4.70-8.82 mL). Basal hormone levels at the time of initial visit to our hospital as follows: the median testosterone level was 0.32 ng/mL(0.24-2.96 ng/mL), median follicle stimulating hormone(FSH) level was 0.56 mIU/mL(0.1-0.75 mIU/mL), and the median luteinizing hormone(LH) level was 0.69 mIU/mL(0.1-1.03 mIU/mL). The levels of other hormones secreted by the anterior pituitary gland were normal. Hypothalamic-pituitary magnetic resonance imaging(MRI) showed that 1 patient had a pituitary microadenoma. Three patients were treated with pulsatile GnRH or gonadotropins, one of which had hypothalamic-pituitary-gonadal(HPG) axis function reversal after GnRH pulse pump therapy and lasted for 1 year, but then still had irreversible reduction.Conclusion:AIHH is marked by adult-onset disease and idiopathic hypogonadism. Enhancing fertility remains a critical requirement for these patients. Pulsatile GnRH treatment or gonadotropin therapy, as viable treatments, exhibit therapeutic effects, albeit with occasional fluctuations. Therefore, the emphasis lies in the timely consideration of fertility preservation.

Given the systematic, rigorous, and practical characteristics of medical disciplines, ensuring the teaching quality of online courses has become a significant focus. In traditional teaching models, teaching supervision is an important method to guarantee instructional quality, and introducing teaching supervision into online teaching activities is of great significance. This article systematically reviews and summarizes the domestic and international experience of conducting online medical courses. We explore the instructional supervision of online medical courses from the following perspectives: the meaning of supervision, the necessity of online supervision, online supervision methods and technical approaches, the feedback and application of supervision information, and the establishment of a standardized online supervision process.

Objective:To investigate the regulation of proliferation and apoptosis of oral squamous cell carcinoma(OSCC)cells by circular RNA hsa_circ_0003221(circPTK2)targeting microrNA(miR)-139-3p/IGF2BP3 axis.Methods:The mRNA expression of circPTK2,miR-139-3p and IGF2BP3 in tissues and cell lines was detected by qRT-PCR.OSCC CAL-27 cells were divided into 5 groups:sh circPTK2,sh NC,sh circPTK2+miR-139-3p inhibitor,sh circPTK2+inhibitor NC and blank control groups.Cell prolifera-tion rate,apoptosis rate,expression of related proteins and IGF2BP3 were respectively detected,and the targeting relationship between miR-139-3p and circPTK2 and IGF2BP3 was respectively verified.Results:The expression of miR-139-3p was decreased in OSCC tissues and the OSCC cell lines,and the mRNA expression of circPTK2 and IGF2BP3 was increased(P＜0.05).Silencing circPTK2 inhibited cell proliferation,decreased mRNA and protein expression of circPTK2 and IGF2BP3,and promoted cell apoptosis and miR-139-3p expression(P＜0.05).miR-139-3p inhibitor reversed the inhibitory effect of silencing circPTK2 on the malignant behavior of CAL-27 cells(P＜0.05).miR-139-3p has a targeting relationship with circPTK2 and IGF2BP3,respectively.Conclusion:Silencing circPTK2 can regulate OSCC cell proliferation and apoptosis through miR-139-3p/IGF2BP3 axis.

Objective:To explore application research of intimacy enhancement therapy in the rehabilition of depression patients, and to provide reference for carrying out depression nursing care.Methods:This study was a randomized controlled trial. From September 2022 to September 2023, a total of 84 depression patients and spouse were selected by convenience sampling method and assigned to the experimental group and control group with 42 cases in each group using the random number table method from Nanfang Hospital, Southern Medical University. The control group applied with routine nursing, and the experimental group implemented intimacy enhancement therapy. Before and 8 weeks after intervention, Hamilton Depression Scale (HAMD-17), Hamilton Anxiety Scale (HAMA-17) and Symptom checklist-90 (SCL-90) were used for assessment.Results:Finally, 81 patients completed the study, including 39 in the experimental group, 13 males and 26 females, aged (36.18 ± 10.93) years old, and 42 in the control group, 17 males and 25 females, aged (38.76 ± 10.90) years old. Before intervention, there was no significant difference in HAMD-17, HAMA-17 and SCL-90 (all P>0.05). After 8 weeks of intervention, the scores of HAMD-17, HAMA-17 scores in the experimental group were (21.00 ± 4.49), (25.38 ± 5.16) points, which were lower than (23.76 ± 6.24), (28.48 ± 5.88) points in the control group; the scores of somatization, interpersonal sensitivity, compulsion, anxiety, depression, others, total SCL-90 in the experimental group were (1.25 ± 0.19), (0.69 ± 0.35), (1.40 ± 0.23), (1.17 ± 0.29), (1.18 ± 0.14), (1.22 ± 0.18), (119.69 ± 9.09) points, which were also lower than (1.82 ± 0.26), (1.53 ± 0.36), (1.69 ± 0.39), (1.88 ± 0.38), (1.73 ± 0.35), (1.31 ± 0.17), (146.19 ± 8.97) points of the control group, the differences were statistically significant ( t values were 2.05-13.20, all P<0.05). Conclusions:Intimacy enhancement therapy can effectively alleviate somatic symptoms and improve prognosis of patients with depression.

Complete androgen insensitivity syndrome(CAIS) is characterized by lack of androgen response in target organs due to androgen receptor dysfunction, resulting in feminized external genitalia. Individuals with CAIS are typically advised to live as females. This article reports a patient diagnosed with CAIS and gender dysphoria in adulthood. Following the removal of a left pelvic mass, pathology indicated cryptorchidism with a concurrent Leydig cell tumor. Genetic testing revealed a deletion mutation in exon 3 of androgen receptor gene. During follow-up, the patient underwent gender reassignment, transitioning socially from female to male. This case provides new insights into gender allocation for CAIS patients.