In this study the MTP1 gene, encoding a type III integral transmembrane protein, was isolated from the rice blast fungus Magnaporthe oryzae. The Mtp1 protein is 520 amino acids long and is comparable to the Ytp1 protein of Saccharomyces cerevisiae with 46% sequence similarity. Prediction programs and MTP1-GFP (green fluorescent protein) fusion expression results indicate that Mtp1 is a protein located at several membranes in the cytoplasm. The functions of the MTP1 gene in the growth and development of the fungus were studied using an MTP1 gene knockout mutant. The MTP1 gene was primarily expressed at the hyphal and conidial stages and is necessary for conidiation and conidial germination, but is not required for pathogenicity. The Deltamtp1 mutant grew more efficiently than the wild type strain on non-fermentable carbon sources, implying that the MTP1 gene has a unique role in respiratory growth and carbon source use.
Fungal Proteins ; genetics ; physiology ; Genes, Fungal ; Magnaporthe ; genetics ; Membrane Proteins ; genetics ; Oryza ; microbiology ; Promoter Regions, Genetic

Fruit ripening is associated with a number of physiological and biochemical changes. They include degradation of chlorophyll, synthesis of flavor compounds, carotenoid biosynthesis, conversion of starch to sugars, cell wall solublisation and fruit softening. These changes are brought about by the expression of specific genes. People are interested in the molecular mechanism involved in the regulation of gene transcription during fruit ripening. Many fruit-specific promoters such as PG, E4, E8, and 2A11 have been characterized and shown to direct ripening-specific expression of reporter genes. AGPase plays the key role in catalyzing the biosynthesis of starch in plants. It is a heterotetrameric enzyme with two small subunits and two large subunits, which are encoded by different genes. In higher plants, small subunits are highly conserved among plant species and expressed in all tissues. And the large subunits are present at multiple isoforms and expressed in a tissue-specific pattern. In fruits, the expression pattern of the large subunits varies with plant species. That made it important to study the transcriptional regulation of the large subunits of AGPase in different plant species. Northern-blot analysis indicates in watermelon, an isoform of the large subunits Wml1 expressed specifically in fruits, not in leaves. The 5' flanking region of Wml1, which covers 1573bp, has been isolated through the method of uneven PCR. And transient expression assay has shown that the 1573bp (named WSP) can direct fruit-specific expression of GUS gene. Our goal in this study was to scan the promoter region for main regulatory regions involved in fruit-specific expression. A chimaeric gene was constructed containing the WSP promoter, the beta-glucuronidase (GUS) structural sequence as a reporter gene and the nopaline synthase polyadenylation site (NOS-ter). The plasmid pSPA was digested with Hind III + Hinc II and promoter fragment of 1573bp (from 180bp to 1752bp) was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-16. The same insert was then cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by HindIII + Bgl II to produce pISPA-16. Three 5'-end deletions of the promoter were obtained and fused to GUS gene in plant transient expression vector pBI426: the 1201bp fragment (from 551bp to 1752bp) was generated by digestion of pBSPA-16 with BamH I + SnaB I, the 898bp fragment (from 854bp to 1752bp) by BamH I + EcoRV. Both fragments were ligated with pBluescript SK(-) digested by BamH I + Sma I, to produce pBSPA-12 and pBS-PA-9. The inserts were cut out with HindmIII + BamH I and ligated with pBI426 digested by Hind III + Bgl II, to produce pISPA-12 and pISPA-9. The 795bp fragment (from 957bp to 1752bp) was generated by digestion of pSPA with Hinc II + EcoR I, promoter fragment was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-8. The same insert were cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by Hind III + Bgl II. The 1573bp fragment and three 5'-end deletions were delivered into watermelon leaf, stem, flower and fruit of different development stages (5, 10, 20 days after pollination) via particle bombardment using a biolistic PDS-1000/He particle gun. Bombardment parameters were as follows: a helium pressure of 1200 psi, vacuum of 91432.23Pa, 7 cm between the stopping screen and the plate. Histochemical assay were done on all the tissues bombarded after incubation for 2 days. The 1573bp fragment had the strongest promoter activity, and can induce GUS expression in fruits of 5 and 20 days after anthesis and flowers, but not in fruits of 10 days after anthesis, leaves and stems. Fragments of 1201bp and 898bp can induce GUS expression only in fruits of 20 days after anthesis, and with lower expression levels than 1573bp. Fragment of 795bp was not able to direct GUS expression in any of the tissues bombarded (data not shown). It can be concluded that of the 1573bp, 1201 bp, 898bp Wml1 5'flanking regions include the necessary information directing fruit-specific expression. Deletion from 180bp to 551bp doesn't affect the fruit-specificity of the promoter, but lowered the expression level. There may be some cis-acting elements located in this region, which can enhance external gene expression in later stages of fruit development. Deletion from 854bp and 958bp led to loss of GUS expression. This region includes the necessary information needed for gene expression as well as the regulatory elements for fruit-specific transcription.
Citrullus ; genetics ; Fruit ; genetics ; Gene Expression Regulation, Plant ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics ; physiology

In previous studies we reported that the expression of HLA-DR on melanoma cell lines was differentially modulated by IFN- gamma and that the transcription rate was responsible for this differential modulation. We have also reported the nucleotide sequence variations in the promoter region of HLA-DR genes, and proposed that differences in the promoter activity by the sequence variations of the HLA-DR promoters might contribute to such a differential transcriptional regulation at the promoter level. In this study, in order to assess whether the sequence variations of the HLA-DR promoters affect the factor binding and exert influence on the promoter activity, nuclear factor binding to our previous six HLA-DRA and fourteen HLA-DRB promoter clones was evaluated with the nuclear protein extracted from a B-lymphoblastoid cell line (BLCL), BH, together with the chloramphenicol acetyltransferase (CAT) reporter assay. In the HLA-DRA promoters, clone 35 containing one bp nucleotide sequence variation at the octamer binding site (OCT) (GATTTGC to GATCTGC) showed relatively weak factor binding. In the HLA-DRB promoters, clusters I, III, and IV of our previous HLA-DRB promoter homologues, containing one bp nucleotide sequence variation (GATTCG) in their Y boxes exhibited weak factor binding and CAT activity compared to other clusters (GATTGG) that showed strong factor binding and CAT activity. This data suggests chat the binding patterns of transcription factors influenced by the nucleotide sequence variations of the HLA-DR promoter could affect the promoter activity and the DNA sequence elements in the HLA-DR promoter could mediate transcriptional regulation.
Base Sequence/genetics ; HLA-DR Antigens/genetics* ; Human ; Melanoma/pathology* ; Melanoma/genetics* ; Molecular Sequence Data ; Nuclear Proteins/metabolism* ; Promoter Regions (Genetics)/physiology* ; Promoter Regions (Genetics)/genetics* ; Tumor Cells, Cultured ; Variation (Genetics)*

We constructed an expression cassette of the organophosphorus pesticide degrading (opd) gene under the control of the E8 promoter. Then opd was transformed into tomato fruit using an agroinfiltration transient expression system. beta-Glucuronidase (GUS) staining, reverse transcription-polymerase chain reaction (RT-PCR), wavelength scanning, and fluorescent reaction were performed to examine the expression of the opd gene and the hydrolysis activity on coumaphos of organophosphorus hydrolase (OPH) in tomato fruit. The results show that the agroinfiltrated tomato fruit-expressed OPH had the maximum hydrolysis activity of about 11.59 U/mg total soluble protein. These results will allow us to focus on breeding transgenic plants that could not only enhance the degrading capability of fruit and but also hold no negative effects on pest control when spraying organophosphorus pesticides onto the seedlings in fields.
Aryldialkylphosphatase ; genetics ; physiology ; Coumaphos ; pharmacology ; Insecticides ; pharmacology ; Lycopersicon esculentum ; genetics ; metabolism ; Plants, Genetically Modified ; Promoter Regions, Genetic

Common warts are close associated with HPVs infection. In this study, we amplified and sequenced the LCR fragment and E2 gene of HPV-2 that infected the patient of extensive common wart with cutaneous horns, and we constructed the recombinant CAT-reporter plasmids pBLCAT-LCR containing HPV-2 prototype or variant LCR and mammalian expression plasmids pcDNA3. 1-E2 containing prototype or variant E2 ORF individually. The promoter activities of HPV-2 variant and the transcriptional repression activities of the mutated E2 protein were evaluated by transient transfection into HeLa cells. The results showed that there were several mutations in LCR and E2 gene of HPV-2 variant. Compared with the prototype, the viral early promoter activity of variant was significantly increased uder the control of LCR. Compared with the wild type E2 protein, the transcriptional repression activities of the mutated E2 protein was abolished partially. We speculate herein that increased promoter activities and decreased repression effect of the mutated E2 protein are linked, at least partially, with the clinical phenotypes of the uncommon huge common wart.
DNA-Binding Proteins ; genetics ; physiology ; Humans ; Mutation ; Oncogene Proteins, Viral ; genetics ; physiology ; Papillomaviridae ; genetics ; Promoter Regions, Genetic ; Repressor Proteins ; physiology ; Warts ; virology

Hepatitis B virus MHBst and HBx fragments were amplified to construct eukaryotic expression vector pCDNA3.1-MHBst and pCDNA3.1-HBx. ST3GalI promoter region was obtained by the method of PCR and GFP report plasmid pEGFP-N1-Psial was constructed. pCDNA3.1-MHBst or pCDNA3.1-HBx with pEGFP-N1-Psial were transiently co-transfected into QGY-7701 cells using calcium phosphate-DNA co-precipitation, respectively. The expressions of Psial-directed GFP were analyzed by FAC-Scalibur. It was found that MHBst/HBx could upregulate ST3GalI promoter activity by 35.2% and 43.8%, respectively. We report the regulation of ST3GalI by MHBst and HBx transactivators. It would be helpful to further investigate the relation between hepatitis B virus infection and sialyltransferase expression.
Gene Expression Regulation, Enzymologic ; Hepatitis B Surface Antigens ; genetics ; physiology ; Hepatitis B virus ; Promoter Regions, Genetic ; Sialyltransferases ; genetics ; Trans-Activators ; genetics ; physiology ; Transfection

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics

Myostatin (Mstn) is a member of the transforming growth factor-beta superfamily that functions as a negative regulator of skeletal muscle growth and differentiation in mammals. The transcriptional regulation of Mstn is controlled by multiple genes including MEF2, which raise the importance of identifying the binding sites of MEF2 on myostatin promoter region and mechanisms underlying. In this study, we investigated the transcriptional regulation of MEF2 on porcine Mstn promoter activity in C2C12 cells. Sequence analysis of the 1 969 bp porcine Mstn promoter region revealed that it contained three potential MEF2 motifs. Using a serial deletion strategy, we tested the activity of several promoter fragments by luciferase assay. Overexpression of MEF2C, but not MEF2A increased Mstn promoter activity in all the promoter fragments with MEF2 motifs by two to six folds, in both C2C12 myoblasts and myotubes. When we transfected exogenous MEF2C, Mstn mRNA level was also upregulated in C2C12 cells, but the protein level was only significantly increased in myotubes. Thus, we propose that MEF2C could modulate and restrain myogenesis by Mstn activation and Mstn-dependent gene processing in porcine. Our research also provided potential targets and an effective molecule to regulate Mstn expression and gave a new way to explore the functional performance of Mstn.
Animals ; Cells, Cultured ; Gene Expression Regulation ; MEF2 Transcription Factors ; Mice ; Muscle, Skeletal ; metabolism ; Myoblasts ; cytology ; Myogenic Regulatory Factors ; genetics ; physiology ; Myostatin ; genetics ; physiology ; Promoter Regions, Genetic ; Swine

In this study, we constructed the plasmid of Sendai virus (SeV) BB1 strain minigenome with Gaussia luciferase (Gluc) as reporter and compared the rescue efficiency of SeV minigenome mediated by T7 promoter with that by CMV promoter. Firstly, the sequence was designed and synthesized which contained hammerhead ribozyme, sequence composed of the trailer, untranslated region of L gene, untranslated region of N gene, and the leader from SeV, and mutant hepatitis delta virus ribozyme sequence. Then, the synthesized sequence was inserted into pVAX1 containing CMV and T7 promoters and the general vector for SeV minigenome pVAX-miniSeV was obtained. Furthermore, pVAX-miniSeV-Gluc (+) and pVAX-miniSeV-Gluc(-) were obtained by inserting Gluc gene into pVAX-miniSeV. From the supernatant of BHK-21 cell transfected with pVAX-miniSeV-Gluc(+), high level of Gluc expression was detection indicating the normal transcription function of CMV promoter. pVAX-SeV-miniGluc(-) and plasmids expressing N,P and L protein of SeV were co-transfected into BST T7/5 cell which derived from BHK-21 and expressed T7 RNA polymerase stably. And high expression of Gluc was found, which indicated that SeV minigenome was efficiently rescued. However, we failed to repeat the result on BHK-21 cell, implying that T7 promoter and CMV promoter may have different effects on the rescue efficiency of SeV minigenome. Therefore, we further constructed SeV minigenome vectors pT7-miniSeV-Gluc (-) and pCMV-miniSeV-Gluc(-) with single promoter of T7 or CMV. Then, these vectors were transfected into BSR T7/ 5 cells respectively accompanied with the N, P, and L protein expression vectors. The result demonstrated that high expression of Gluc was found in the group of pT7-miniSeV-Gluc(-), which failed in the group of pCMV-miniSeV-Gluc(-). It indicated that T7 promoter significantly increased the rescue efficiency of SeV minigenome. We successfully constructed a SeV minigenome vector with secreted luciferase gene as report er and proved T7 promoter can enhance the rescue efficiency of SeV minigenome, which provides basis for construction of infectious clone containing SeV full-length genome.
Animals ; Cell Line ; Cricetinae ; Cytomegalovirus ; genetics ; DNA-Directed RNA Polymerases ; genetics ; Genome, Viral ; Humans ; Promoter Regions, Genetic ; Respirovirus Infections ; virology ; Sendai virus ; genetics ; physiology ; Viral Proteins ; genetics ; metabolism

The present study was aimed at investigating the effect of activin on the activity of human growth hormone (hGH) gene promoter in rat pituitary GH3 cells and the underlying molecular mechanism. The method of luciferase reporter gene was used. We firstly established a stable GH3 cell line which contains hGH gene promoter (-484 to 30 bp) and luciferase reporter gene by transfecting pGL3-484-Luc2 luciferase expression plasmid into GH3 cells using Lipofectamine transfection reagent. After treating these cells with activin or activin plus various signaling transduction activators, the concentration of GH in the medium and lysate of GH3 cells and luciferase activities in GH3 cells were measured. The results showed that activin (5 nmol/L, 50 nmol/L) decreased the secretion and synthesis of GH. The amounts of GH content in GH3 lysate and medium treated with 50 nmol/L activin were 82% and 59% of the control, respectively. Furthermore, activin (5, 50 nmol/L) reduced the luciferase expression in stable GH3 cells, with the expression being 77% and 69% of the control (P<0.001). Among the activators of intracellular signaling transduction pathways, mitogen-activated protein kinases kinase (MAPKK/MEK) activators C(6) ceramide (1 micromol/L) abolished completely the inhibitory effect of activin. Western blot analysis further confirmed the inhibition of phosphorylated MEK in GH3 cells. The inhibitory effect of activin was abrogated following the deletion of the fragment from -132 to -66 bp within the hGH gene promoter. These results indicate that activin decreases the activity of hGH gene promoter in rat pituitary GH3 cells. The intracellular MEK dependent signaling pathway and the promoter sequence that spans the -132 to -66 bp fragment of hGH gene are involved in the inhibitory effect of activin.
Activins ; physiology ; Animals ; Cell Line ; Cells, Cultured ; Genes, Regulator ; Genes, Reporter ; genetics ; Human Growth Hormone ; genetics ; Humans ; Luciferases ; genetics ; Promoter Regions, Genetic ; genetics ; Rats ; Somatotrophs ; cytology ; metabolism ; Transfection