This study aims to systematically characterize the targeted effects of Quanduzhong Capsules on cartilage lesions in knee osteoarthritis by integrating spatial transcriptomics data mining and animal experiments validation, thereby elucidating the related molecular mechanisms. A knee osteoarthritis model was established using Sprague-Dawley(SD) rats, via a modified Hulth method. Hematoxylin and eosin(HE) staining was employed to detect knee osteoarthritis-associated pathological changes in knee cartilage. Candidate targets of Quanduzhong Capsules were collected from the HIT 2.0 database, followed by bioinformatics analysis of spatial transcriptomics datasets(GSE254844) from cartilage tissues in clinical knee osteoarthritis patients to identify spatially specific disease genes. Furthermore, a "formula candidate targets-spatially specific genes in cartilage lesions" interaction network was constructed to explore the effects and major mechanisms of Quanduzhong Capsules in distinct cartilage regions. Experimental validation was conducted through immunohistochemistry using animal-derived biospecimens. The results indicated that Quanduzhong Capsules effectively inhibited the degenerative changes in the cartilage of affected joints in rats, which was associated with the regulation of Quanduzhong Capsules on the thioredoxin-interacting protein(TXNIP)-NOD-like receptor family pyrin domain containing 3(NLRP3)-bone morphogenetic protein receptor type 2(BMPR2)-fibronectin 1(FN1)-matrix metallopeptidase 2(MMP2) signal axis in the articular cartilage surface and superficial zones, subsequently inhibiting cartilage matrix degradation leading to oxidative stress and inflammatory diffusion. In summary, this study clarifies the spatially specific targeted effects and protective mechanisms of Quanduzhong Capsules within pathological cartilage regions in knee osteoarthritis, providing theoretical and experimental support for the clinical application of this drug in the targeted therapy on the inflamed cartilage.
Animals ; Osteoarthritis, Knee/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Male ; Humans ; Capsules ; Female ; Disease Models, Animal

Traditional Chinese medicine(TCM) is the pillar for the development of motherland medicine, and animal medicine has a long history of application in China, characterized by wide resources, strong activity, definite efficacy, and great benefits. It has significant potential and important status in the consumption market of raw materials of TCM. In the context of global climate change, farming system alterations, and low renewability, the depletion of wild medicinal animal resources has accelerated. Accordingly, the conservation and sustainable utilization of wild resources of animal medicinal materials has become a problem that garners increasing attention and urgently needs to be solved. This paper summarizes the current situation of domestic and foreign medicinal animal breeding and research progress in industrial application in recent years and points out the issues related to standardized breeding, germplasm selection and breeding, and quality evaluation standards for medicinal animals. Furthermore, this paper discusses standardized breeding, quality standards, resource protection and utilization, and the search for alternative resources for rare and endangered medicinal animals. It proposes that researchers should systematically carry out in-depth basic research on animal medicine, improve the breeding scale and level of medicinal animals, employ modern technology to enhance the quality standards of medicinal materials, and strengthen the research and development of alternative resources. This approach aims to effectively address the relationship between protection and utilization and make a significant contribution to the sustainable development of medicinal animal resources and the animal-based Chinese medicinal material industry.
Animals ; Breeding ; China ; Medicine, Chinese Traditional ; Conservation of Natural Resources

Viral infectious diseases, characterized by their intricate nature and wide-ranging diversity, pose substantial challenges in the domain of data management. The vast volume of data generated by these diseases, spanning from the molecular mechanisms within cells to large-scale epidemiological patterns, has surpassed the capabilities of traditional analytical methods. In the era of artificial intelligence (AI) and big data, there is an urgent necessity for the optimization of these analytical methods to more effectively handle and utilize the information. Despite the rapid accumulation of data associated with viral infections, the lack of a comprehensive framework for integrating, selecting, and analyzing these datasets has left numerous researchers uncertain about which data to select, how to access it, and how to utilize it most effectively in their research.This review endeavors to fill these gaps by exploring the multifaceted nature of viral infectious diseases and summarizing relevant data across multiple levels, from the molecular details of pathogens to broad epidemiological trends. The scope extends from the micro-scale to the macro-scale, encompassing pathogens, hosts, and vectors. In addition to data summarization, this review thoroughly investigates various dataset sources. It also traces the historical evolution of data collection in the field of viral infectious diseases, highlighting the progress achieved over time. Simultaneously, it evaluates the current limitations that impede data utilization.Furthermore, we propose strategies to surmount these challenges, focusing on the development and application of advanced computational techniques, AI-driven models, and enhanced data integration practices. By providing a comprehensive synthesis of existing knowledge, this review is designed to guide future research and contribute to more informed approaches in the surveillance, prevention, and control of viral infectious diseases, particularly within the context of the expanding big-data landscape.
Big Data ; Humans ; Virus Diseases/virology* ; Artificial Intelligence

OBJECTIVE: To investigate the clinical effect of minimally invasive technique in the treatment of moderate and severe gluteal muscle contracture. METHODS: A retrospective study was conducted on 85 patients (170 sides) with bilateral gluteal muscle contracture admitted from January 2016 to December 2019. All patients were treated with minimally invasive release of tendon knife. There were 32 males and 53 females, ranging in age from 15 to 37 years old, with an average age of (22.3±6.3) years old. Operation time, intraoperative blood loss, incision length, first postoperative ambulation time, complication rate, recurrence rate, and Harris hip score (HHS) were analyzed and evaluated. RESULTS: The average follow-up time was (16.2±4.6) months, ranging from 12 to 30 months. The operation time ranged from 7 to 15 min, with an average of (10.2±3.1) min. Intraoperative blood loss ranged from 2 to 20 ml, with an average of (8.4±2.2) ml. The incision length ranged from 0.6 to 2.0 cm, with an average of (0.8±0.3) cm. The time to postoperative ambulation ranged from 12 to 28 h, with an average of (20.0±3.2) h. All patients achieved primary wound healing without sciatic nerve injury or recurrence. HHS hip function scores ranged from 90 to 98, with an average score of (96.2±1.4). Complications included intraoperative tendon blade tip fracture in two cases (removed under fluoroscopic guidance) and subcutaneous hematoma in three cases-two resolved with compression and one with open evacuation.. Twenty-nine patients exhibited transient swaying gait postoperatively, of which 24 patients returned to normal after 4 weeks and 5 patients returned to normal after 6 weeks. CONCLUSION Minimally invasive tendon blade release is a safe and effective technique for treating gluteal muscle contracture, offering minimal trauma, rapid recovery, and excellent cosmetic and functional outcomes. However, it exhibits a low risk of blade tip fracture and sciatic nerve injury, warranting experienced surgical handling.
Humans ; Male ; Female ; Adult ; Minimally Invasive Surgical Procedures/methods* ; Adolescent ; Retrospective Studies ; Buttocks/surgery* ; Young Adult ; Contracture/surgery* ; Tendons/surgery* ; Muscle, Skeletal/surgery*

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion is one of the most commonly used supportive treatments for children with hematological diseases. This guideline provides guidance and recommendations for blood transfusions in children with aplastic anemia, thalassemia, autoimmune hemolytic anemia, glucose-6-phosphate dehydrogenase deficiency, acute leukemia, myelodysplastic syndromes, immune thrombocytopenic purpura, and thrombotic thrombocytopenic purpura. This article presents the evidence and interpretation of the blood transfusion provisions for children with hematological diseases in the "Guideline for pediatric transfusion", aiming to assist in the understanding and implementing the blood transfusion section of this guideline.
Humans ; Child ; Hematologic Diseases/therapy* ; Blood Transfusion/standards* ; Practice Guidelines as Topic

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion for children undergoing hematopoietic stem cell transplantation is highly complex and challenging. This guideline provides recommendations on transfusion thresholds and the selection of blood components for these children. This article presents the evidence and interpretation of the transfusion provisions for children undergoing hematopoietic stem cell transplantation, with the aim of enhancing the understanding and implementation of the "Guideline for pediatric transfusion".
Humans ; Hematopoietic Stem Cell Transplantation ; Child ; Blood Transfusion/standards* ; Practice Guidelines as Topic

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Critically ill children often present with anemia and have a higher demand for transfusions compared to other pediatric patients. This guideline provides guidance and recommendations for blood transfusions in cases of general critical illness, septic shock, acute brain injury, extracorporeal membrane oxygenation, non-life-threatening bleeding, and hemorrhagic shock. This article interprets the background and evidence of the blood transfusion provisions for critically ill and severely bleeding children in the "Guideline for pediatric transfusion", aiming to enhance understanding and implementation of this aspect of the guidelines. Citation:Chinese Journal of Contemporary Pediatrics, 2025, 27(4): 395-403.
Humans ; Critical Illness ; Blood Transfusion/standards* ; Child ; Hemorrhage/therapy* ; Practice Guidelines as Topic

OBJECTIVES: To investigate the clinical characteristics and prognosis of chronic disseminated candidiasis (CDC) in children with acute leukemia (AL) following chemotherapy. METHODS: A retrospective analysis was conducted on children diagnosed with CDC (including confirmed, clinically diagnosed, and suspected cases) after AL chemotherapy from January 2015 to December 2023 at Fujian Medical University Union Hospital, Zhangzhou Municipal Hospital, and Quanzhou First Hospital Affiliated to Fujian Medical University. Clinical characteristics and prognosis were analyzed. RESULTS: The incidence of CDC in children with AL following chemotherapy was 1.92% (32/1 668). Among the children with acute lymphoblastic leukemia, the incidence of CDC in the high-risk group was significantly higher than in the low-risk group (P=0.002). All patients presented with fever unresponsive to antibiotics during the neutropenic period, with 81% (26/32) involving the liver. C-reactive protein (CRP) levels were significantly elevated (≥50 mg/L) in 97% (31/32) of the patients. The efficacy of combined therapy with liposomal amphotericin B and caspofungin or posaconazole for CDC was 66% (19/29), higher than with caspofungin (9%, 2/22) or liposomal amphotericin B (18%, 2/11) monotherapy. The overall cure rate was 72% (23/32). The proportion of patients with CRP ≥50 mg/L and/or a positive β-D-glucan test for more than 2 weeks and breakthrough infections during caspofungin treatment was significantly higher in the treatment failure group compared to the successful treatment group (P<0.05). CONCLUSIONS CDC in children with AL after chemotherapy may be associated with prolonged neutropenia due to intensive chemotherapy. Combination antifungal regimens based on liposomal amphotericin B have a higher cure rate, while persistently high CRP levels and positive β-D-glucan tests may indicate poor prognosis.
Adolescent ; Child ; Child, Preschool ; Female ; Humans ; Infant ; Male ; Antifungal Agents/therapeutic use* ; Candidiasis/diagnosis* ; Chronic Disease ; Leukemia/complications* ; Precursor Cell Lymphoblastic Leukemia-Lymphoma/complications* ; Prognosis ; Retrospective Studies