Phenylalanine ammonia-lyase (PAL) is the key entry enzyme of plant phenylpropanoid pathway. It plays an important role in the biosynthesis of podophyllotoxin, an anti-tumor lignan that is currently produced from its main natural source Sinopodophyllum hexandrum (Royle) Ying. In this study, we cloned the gene ShPAL encoding phenylalanine ammonia-lyase by RT-PCR from the root of S. hexandrum ecotype inhabited in the Aba' district, Sichuan, based on its public SRA transcriptome data-package. Bioinformatics analyses showed that the ShPAL-encoded protein is composed of 711 amino acids, contains the conserved domains of PAL, and has the signature motif within the active center of aromatic ammonia-lyases. Moreover, ShPAL protein was predicted to have a secondary structure mainly composed of α-helix and random coil, a typical 'seahorse' shape monomer tertiary structure, and a homologous tetramer three-dimensional structure by Swiss-Modelling. The phylogenetic lineage analysis indicated ShPAL was of the highest sequence identity and the shortest evolutionary distance with the PAL of Epimedium sagittatum from the same Berberidaceae family. Subcellular localization experiments showed that ShPAL protein was mainly distributed in the cytoplasm, despite of a minority on the endoplasmic reticulum membrane. Furthermore, ShPAL protein was recombinantly expressed in Escherichia coli and purified by histidine-tag affinity chromatography. Its enzymatic activity was determined up to 20.91 U/mg, with the optimum temperature of 41 ℃ and pH of 9.0. In contrast, the enzyme activity of its F130H mutant decreased by about 23.6%, yet with the same trends of change with temperature and pH, confirming that phenylalanine at this position does affect the substrate specificity of PAL. Both the wild type and the mutant have relatively poor thermostability, but good pH-stability. These results may help to further investigate the regulatory role of PAL in the process of podophyllotoxin biosynthesis and advance the heterologous synthesis of podophyllotoxin to protect the germplasm resource of S. hexandrum. They also demonstrate that ShPAL has a potential application in biochemical industry and biomedicine.
Phenylalanine Ammonia-Lyase/metabolism* ; Podophyllotoxin ; Phylogeny ; Cloning, Molecular

L-Phenylalanine is one of the essential amino acids that cannot be synthesized in mammals in adequate amounts to meet the requirements for protein synthesis. Fungi and plants are able to synthesize phenylalanine via the shikimic acid pathway. L-Phenylalanine, derived from the shikimic acid pathway, is used directly for protein synthesis in plants or metabolized through the phenylpropanoid pathway. This phenylpropanoid metabolism leads to the biosynthesis of a wide array of phenylpropanoid secondary products. The first step in this metabolic sequence involves the action of phenylalanine ammonia-lyase (PAL). The discovery of PAL enzyme in fungi and the detection of 14CO2 production from 14C-ring-labeled phenylalanine and cinnamic acid demonstrated that certain fungi can degrade phenylalanine by a pathway involving an initial deamination to cinnamic acid, as happens in plants. In this review, we provide background information on PAL and a recent update on the presence of PAL genes in fungi.
Amino Acids, Essential ; Cinnamates ; Deamination ; Fungi ; Mammals ; Phenylalanine ; Phenylalanine Ammonia-Lyase ; Plants ; Resin Cements ; Shikimic Acid

Phenylalanine ammonia-lyase (PAL), which catalyzes the conversion from L-phenylalanine to trans-cinnamic acid, is a well-known key enzyme and a connecting step between primary and secondary metabolisms in the phenylpropanoid biosynthetic pathway of plants and microbes. Schisandra chinensis, a woody vine plant belonging to the family of Magnoliaceae, is a rich source of dibenzocyclooctadiene lignans exhibiting potent activity. However, the functional role of PAL in the biosynthesis of lignan is relatively limited, compared with those in lignin and flavonoids biosynthesis. Therefore, it is essential to clone and characterize the PAL genes from this valuable medicinal plant. In this study, molecular cloning and characterization of three PAL genes (ScPAL1-3) from S. chinensis was carried out. ScPALs were cloned using RACE PCR. The sequence analysis of the three ScPALs was carried out to give basic characteristics followed by docking analysis. In order to determine their catalytic activity, recombinant protein was obtained by heterologous expression in pCold-TF vector in Escherichia coli (BL21-DE3), followed by Ni-affinity purification. The catalytic product of the purified recombinant proteins was verified using RP-HPLC through comparing with standard compounds. The optimal temperature, pH value and effects of different metal ions were determined. V_max, K_cat and K_m values were determined under the optimal conditions. The expression of three ScPALs in different tissues was also determined. Our work provided essential information for the function of ScPALs.
Cloning, Molecular ; Escherichia coli/metabolism* ; Phenylalanine/metabolism* ; Phenylalanine Ammonia-Lyase/chemistry* ; Recombinant Proteins ; Schisandra/genetics*

Animals ; Biopterin ; analogs & derivatives ; therapeutic use ; Genetic Therapy ; Humans ; Phenylalanine Ammonia-Lyase ; administration & dosage ; Phenylketonurias ; therapy

In order to reveal the induced resistance mechanism of tobacco treated with copper solution to potato virus Y-vein necrosis strain (PVY(N)), disease indexes, contents of virus and some physiological and biochemical indexes in tobacco were studied. The results showed that when treated at the copper concentration of 0.8 mg x L(-1), the symptom displayed and vein necrosis on tobacco were postponed, the disease index and content of virus sharply decreased , and the content of chlorophyll a, chlorophyll b and phenylalanine ammonia lyase (PAL) activity remarkably increased. Furthermore, vein necrosis closely linked to contents of total phenol and flavonoid. In this study, the contents of total phenol and flavonoid were promoted when treated with a solution at the copper concentration of 0.8 mg x L(-1). But the contents of total phenol and flavonoid reached to the first peak at the 3rd day after inoculation, and then decreased to the lowest levels which even were lower than those of the control after inoculating PVY(N). Then the contents of total phenol and flavonoid increased slowly from the 6td but still lower than those of the control. The result implied that spraying copper solution might play an important role in induced resistance of tobacco to vein necrosis disease and strengthen the antiviral capability to PVY(N).
Chlorophyll ; metabolism ; Copper ; pharmacology ; Immunity, Innate ; drug effects ; Phenylalanine Ammonia-Lyase ; metabolism ; Potyvirus ; growth & development ; Tobacco ; drug effects ; metabolism ; virology

Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi.
Agaricales* ; Amino Acid Sequence ; Amino Acids ; Amino Acids, Aromatic ; Clinical Coding ; Clone Cells* ; Cloning, Organism* ; Flammulina* ; Fruit* ; Fungi ; Gene Expression ; Introns ; Mycelium* ; Phenylalanine Ammonia-Lyase* ; Phenylalanine* ; Tricholoma ; Tyrosine

To construct a safer and more efficient gene engineering Lactococcus Lactis for expressing phenylalaine ammonia lyase (PAL) which will be benefit for PKU therapy, pal cDNA of Parsly and synthesized sequence based on Lactococcus Lactis bias codons were recombined into two Lactococcus Lactis NICE systems. The activities of the expressed PAL were detected, and the effect of Lactococcus Lactis bias codons on the expression of exterior protein was analyzed. The results showed that the expression level of PAL was increased by using Lactococcus Lactis bias codons in both Lactococcus Lactis NICE systems. Through which several safer andmore efficient strains of the gene engineering Lactococcus Lactis were obtained.
Cloning, Molecular ; Codon ; genetics ; Genetic Vectors ; genetics ; Lactococcus lactis ; genetics ; metabolism ; Phenylalanine Ammonia-Lyase ; biosynthesis ; genetics ; Recombinant Proteins ; biosynthesis ; metabolism ; Transformation, Bacterial

We studied the influence of the concentration of Ca2+ (0-50 mmol/L) in culture medium on the synthesis of rosmarinic acid (RA) and related enzymes in Salvia miltiorrhiza suspension cultures. Using verpamil (VP, a calcium channel antagonist) and ionophore A23187, we studied the mechanism of secondary metabolites of Salvia miltiorrhiza suspension cultures influenced by the concentration of Ca2+ in the culture medium. The synthesis of intracellular RA in 6-day incubation was significantly dependent on the medium Ca2+ concentration. At the optimal Ca2+ concentration of 10 mmol/L, a maximal RA content of 20.149 mg/g biomass dry weight was reached, which was about 37.3% and 20.4% higher than that at Ca2+ concentrations of 1 and 3 mmol/L, respectively. The variation of the activity of PAL and TAT, two key enzymes of the two branches of RA, could be affected by the concentration of Ca2+ in culture medium. The change of their activity occurred prior to the accumulation of RA, which suggested both of the key enzymes be involved in the synthesis of RA. Meanwhile, the enzymatic action of PAL was more distinct than TAT. The treatment of VP and A23187, respectively, indicated that the influence of RA affected by the concentration of Ca2+ in the culture medium was accomplished by the intracellular Ca2+, and the flow of Ca2+ from the extracellular to the intracellular environment could also participate in this process.
Calcium ; pharmacology ; Cinnamates ; metabolism ; Culture Media ; Culture Techniques ; methods ; Depsides ; metabolism ; Phenylalanine Ammonia-Lyase ; metabolism ; Salvia miltiorrhiza ; chemistry ; enzymology ; growth & development ; Tyrosine Transaminase ; metabolism

To investigate roles of nitric oxide (NO) signal in accumulations of phenolic acids in abscisic.acid (ABA)-induced Salvia miltiorrhiza hairy roots, S. miltiorrhiza hairy roots were treated with different concentrations of sodium nitroprusside (SNP)-an exogenous NO donor, for 6 days, and contents of phenolic acids in the hairy roots are determined. Then with treatment of ABA and NO scavenger (2-(4-carboxy-2-phenyl)-4,4,5,5-tetramethylimidazoline-1- oxyl-3-oxide, c-PTIO) or NO synthase inhibitor (NG-nitro-L-arginine methyl ester, L-NAME), contents of phenolic acids and expression levels of three key genes involved in phenolic acids biosynthesis were detected. Phenolic acids production in S. miltiorrhiza hairy roots was most significantly improved by 100 µmoL/L SNP. Contents of RA and salvianolic acid B increased by 3 and 4 folds. ABA significantly improved transcript levels of PAL (phenylalanine ammonia lyase), TAT (tyrosine aminotransferase) and RAS (rosmarinic acid synthase), and increased phenolic acids accumulations. However, with treatments of ABA+c-PTIO or ABA+L-NAME, accumulations of phenolic acids and expression levels of the three key genes were significantly inhibited. Both NO and ABA can increase accumulations of phenolic acids in S. miltiorrhiza hairy roots. NO signal probably mediates the ABA-induced phenolic acids production.
Abscisic Acid ; pharmacology ; Benzofurans ; metabolism ; Free Radical Scavengers ; pharmacology ; Hydroxybenzoates ; metabolism ; Nitric Oxide ; metabolism ; Phenylalanine Ammonia-Lyase ; metabolism ; Plant Roots ; metabolism ; Salvia miltiorrhiza ; metabolism ; Tyrosine Transaminase ; metabolism

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics