Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.

Objective To study the relationship of serum visfatin level and coronary heart disease (CHD). Methods Eighty eight hospitalized patients were enrolled into the study and divided into CHD group(n = 62) and non-CHD control group(n = 26) according to the angiography results; the CHD group was further divided into single-, double-, multi-vessel affected groups. The serum level of visfatin was measured by ELISA,the lesion severity of coronary arteries was assessed by Gensini coronary scoring system, and the correlation between serum visfatin level and coronary lesion severity was evaluated statistically. Results The level of serum visfatin was significantly higher in CHD group than the control group([ 10. 77 ± 2. 63 ] μg/L vs. [ 7. 13 ± 2. 06 ]μg/L,P ＜ 0. 05). The visfatin level increased along with the the number of stenosis vessels(P ＜ 0. 05). The sermn visfatin levels of no stenosis, single-, double-, multi-vessel groups were(7. 13 ± 2. 06) μg/L,(9. 30±2. 19) μg/L,(10. 81 ± 2. 12) μg/L,(12. 79 ± 2. 20) μg/L respectively. A significant positive correlation was found between coronary lesion severity score and serum visfatin level(r = 0. 483, P ＜ 0. 01). Conclusion The visfatin may be directly related to the initiation and development of coronary diseases. The higher level of serum visfatin was, the more severe coronary artery disease would be.

OBJECTIVE: To explore the correlation of plasma N-acetyl-neuraminic acid level with Thrombolysis In Myocardial Infarction (TIMI) risk score and clinical outcomes of patients with acute coronary syndrome (ACS). METHODS: We consecutively enrolled 708 consecutive patients (401 male and 307 female, mean age 63.6±10.6 years) undergoing coronary angiography in our hospital between October, 2018 and July, 2019, including 597 patients with ACS and 111 without ACS (control group). The patients with ACS group were divided into high (=104), moderate (=425) and low (=68) risk groups according to their TIMI risk scores. All the participants were examined for plasma Neu5Ac level using liquid chromatography-tandem mass spectrometry and underwent coronary angiography with their Gensini scores calculated. The patients with ACS were followed up after discharge for a mean of 15 months for the occurrence of major adverse cardiac events (Mace). Binary logistic regression analysis was performed to identify the risk factors of Mace in these patients. RESULTS: Plasma Neu5Ac levels were significantly higher in ACS group than in the control group ( < 0.05). ROC curve analysis showed that plasma Neu5Ac level could assist in the diagnosis of ACS (0.648 [0.597-0.699]) with a sensitivity of 39.2% and a specificity of 86.5% at the cutoff value of 288.50 ng/mL. In the ACS patients, plasma Neu5Ac level was significantly higher in the high-risk group than in the moderate-risk and low-risk groups ( < 0.05) and could assist in the diagnosis of a high risk (0.645 [0.588-0.703]) with a sensitivity of 42.3% and a specificity of 80.1% at the cutoff value of 327.50 ng/ mL. Plasma Neu5Ac was positively correlated with age, serum uric acid, creatinine, lipoprotein a, Ddimer, C-reactive protein, MB isoform of creatine kinase and Gensini score and negatively correlated with high-density lipoprotein level. During the followup, 80 ACS patients experienced Mace, who had significantly higher plasma Neu5Ac level than those without Mace (=517). Logistic regression analysis showed that plasma Neu5Ac level and a history of previous stroke were independent risk factors for the occurrence of Mace. CONCLUSIONS Plasma Neu5Ac level can provide assistance in the diagnosis and risk stratification of ACS and is an independent risk factor for prognosis of ACS patients.