OBJECTIVE: To report on a rare case of Neurofibromatosis type 2 (NF2) manifesting as oculomotor nerve palsy and explore its genetic basis. METHODS: A patient with NF2 who had presented at Beijing Ditan Hospital Affiliated to Capital Medical University on July 10, 2021 was selected as the study subject. Cranial and spinal cord magnetic resonance imaging (MRI) was carried out on the patient and his parents. Peripheral blood samples were collected and subjected to whole exome sequencing. Candidate variant was verified by Sanger sequencing. RESULTS: MRI revealed bilateral vestibular Schwannomas, bilateral cavernous sinus meningiomas, popliteal neurogenic tumors, and multiple subcutaneous nodules in the patient. DNA sequencing revealed that he has harbored a de novo nonsense variant of the NF2 gene, namely c.757A>T, which has replaced a codon (AAG) encoding lysine (K) at position 253 with a stop codon (TAG). This has resulted in removal of the Merlin protein encoded by the NF2 gene from position 253 onwards. The variant was not found in public databases. Bioinformatic analysis suggested that the corresponding amino acid is highly conserved. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was rated as pathogenic (PVS1+PS2+PM2_Supporting+PP3+PP4). CONCLUSION The heterozygous nonsense variant c.757A>T (p.K253*) of the NF2 gene probably underlay the disease in this patient with an early onset, atypical but severe phenotype.
Male ; Humans ; Neurofibromatosis 2/genetics* ; Genes, Neurofibromatosis 2 ; Oculomotor Nerve Diseases/genetics* ; Computational Biology ; Genomics ; Mutation

Cytogenetic analysis of 4 cases of meningiomas from 3 male and 1 female patients is reported. One of male patients suffered from neurofibromatosis type 2. Histologically, the meningiomas were meningotheliomatous (1), transitional (2), and psammomatous (1). Chromosomal abnormalities were found in all cases with a karyotype 45,XY,-22, 45,XY,-16, 45,XX,-2, and 45,XY,t (15p;22q), respectively. Monosomy of chromosome 22 was detected only in the patient with neurofibromatosis type 2. These cytogenetic analysis demonstrates that variable clonal karyotype aberrations exist in meningiomas.
Adolescent ; Adult ; *Chromosome Aberrations ; Female ; Humans ; Male ; Meningeal Neoplasms/*genetics ; Meningioma/*genetics ; Neurofibromatosis 2/genetics

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics

OBJECTIVETo investigate the impact of S518 phosphorylation in Merlin on the interaction with CD44 in vestibular schwannoma and the tumor growth.

METHODSThirty-five samples of vestibular schwannoma were identified by pathology. Immunohistopathology and western blot were employed to analyze the expression and localization of S518 phosphorylated Merlin in the tumor tissues. Nerve tissues that were collected during other surgical operation were used as control. The expression level of S518 phosphorylated Merlin was compared with clinical stages, tumor size, clinical course and cystic degeneration. Immunoprecipitation was used to evaluate the impact of S518 phosphorylation in Merlin on the interaction with CD44.

RESULTSIn vestibular schwannoma, Merlin was phosphorylated at S518 and demonstrated perinuclear localization. The S518 phosphorylation level was much lower in the normal control nerve tissues than that in vestibular schwannoma tissues. There was no correlation between the phosphorylation level on Merlin and clinical stages, tumor size, clinical course and cystic degeneration. The S518 phosphorylated Merlin bound CD44 was higher than wild-type Merlin bound CD44 in vestibular schwannoma tissues.

CONCLUSIONSThe affinity of Merlin to CD44 was increased after phosphorylation at S518. Different cellular biological results might be triggered through binding to wild type Merlin and S518 phosphorylated Merlin.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Hyaluronan Receptors ; genetics ; metabolism ; Male ; Middle Aged ; Neoplasm Staging ; Neurofibromin 2 ; genetics ; metabolism ; Neuroma, Acoustic ; genetics ; metabolism ; pathology ; Phosphorylation

OBJECTIVETo report a heterozygous RNA-splicing mutation (IVS3+ 3A to C) of NF2 gene in a Chinese family with autosomal dominant neurofibromatosis type II and investigate the relationship between the genotype and phenotype.

METHODSThe proband with bilateral vestibular schwannomas underwent gamma knife radiosurgery two years earlier. DNA of blood samples from all affected individuals, suspected individuals and unaffected relatives of the family was extracted and amplified to detect the polymorphisms at loci D22S1150 and D22S268 that are linked with the NF2 gene. Two-point LOD score was calculated. The promoter region, 17 exons and exon/intron boundaries of NF2 gene were amplified and sequenced for the proband. The exon 3/intron 3 boundaries of NF2 gene was amplified and sequenced for the other 3 patients, 1 suspected individual, 9 unaffected members of the family and 150 unrelated controls.

RESULTSThe result of two-point linkage analysis suggested that NF2 gene was a candidate gene (Zmax= 2.109, θ = 0.00, locus D22S1150). DNA sequencing revealed a heterozygous splicing mutation in intron 3 (IVS3+ 3A to C) for the proband. Identical mutation was also observed in the other 3 patients and 1 suspected individual. No mutation was found in the 9 normal family members and 150 unrelated controls, which was consistent with the clinical diagnosis.

CONCLUSIONThis is the first report of familial neurofibromatosis type II with a splicing mutation of IVS3+ 3A to C of the NF2 gene. The mutation might be responsible for the neurofibromatosis type II in the family.

Adult ; Animals ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; DNA Mutational Analysis ; methods ; Dogs ; Female ; Genetic Linkage ; Humans ; Male ; Mice ; Middle Aged ; Mutation ; genetics ; Neurofibromatosis 2 ; genetics ; pathology ; physiopathology ; Neurofibromin 2 ; genetics ; Pedigree ; RNA Splicing ; genetics ; Sequence Alignment

BACKGROUND: Neurofibromatosis type 2 (NF2) is an autosomal dominant syndrome caused by the NF2 tumor suppressor gene. However, the NF2 mutation characteristics in Korean patients are not sufficiently understood. In this study, we conducted a comprehensive mutational analysis in 7 Korean NF2 patients by performing direct sequencing and gene-dosage assessment. METHODS: We analyzed all exons and flanking regions of NF2 by direct sequencing and screened the deletions or duplications involving NF2 by multiplex ligation-dependent probe amplification. RESULTS: Four novel NF2 mutations, including 2 splice-site mutations (c.364-1G>A and c.886-3C>G), 1 frameshift mutation (c.524delA), and 1 missense mutation (c.397T>C; p.Cys133Arg), were identified in our patients. No large deletion or duplication was identified in our series. Subsequently, we identified an abnormal splicing product by using reverse transcription-PCR and direct sequencing in 2 patients with a novel splice-site mutation. The missense mutation c.397T>C was predicted to have harmful effects on protein function. CONCLUSIONS: The detection rate of NF2 mutations in Korean patients (57%) is similar to those in other populations. Our results provided a greater insight into the mutational spectrum of the NF2 gene in Korean subjects.
3' Flanking Region/genetics ; 5' Flanking Region/genetics ; Adult ; Aged ; Amino Acid Sequence ; Asian Continental Ancestry Group/*genetics ; Child, Preschool ; Exons ; Female ; Frameshift Mutation ; *Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Molecular Sequence Data ; *Mutation ; Mutation, Missense ; Neurofibromatosis 2/diagnosis/*genetics ; RNA Splice Sites ; Republic of Korea ; Sequence Analysis, DNA ; Young Adult

BACKGROUNDSchwannoma is the tumor arising mainly from the cranial and spinal nerves. Bilateral vestibular schwannoma is the hallmark of neurofibromatosis type 2 (NF2). The NF2 gene has been cloned with comprehensive analysis of its mutations in schwannoma. However, most studies focused on vestibular schwannoma. There are differences in proliferation of tumor cell and ultrastructure between vestibular and spinal schwannomas. It is unknown whether genetic alterations in vestibular schwannoma are different from those in non-vestibular schwannoma. We analyzed the loss of heterozygosity (LOH) on chromosome 22 in patients with sporadic schwannoma including vestibular and spinal schwannomas and correlated this genetic alteration with tumor proliferation.

METHODSIn 54 unrelated patients without clinical NF1 or NF2, 36 patients had sporadic vestibular schwannoma, and 18 dorsal spinal root schwannoma. Four highly polymorphic linkage to NF2 gene microsatellite DNA markers (D22S264, D22S268, D22S280, CRYB2) were used to analyze LOH. The proliferative index was evaluated by Ki-67 and proliferative cell nuclear antigen (PCNA) immunostaining. Student's t test was used to analyze the difference of the proliferative index between schwannoma with LOH and that without LOH. The difference of the frequency of LOH in vestibular and spinal schwannomas was investigated by the chi-square test.

RESULTSTwenty-three schwannomas (42.6%, 23/54) showed allele loss. The frequency of LOH in vestibular schwannoma was significantly higher than that in spinal schwannoma (chi2 = 5.14, P < 0.05). The proliferative index of schwannoma with LOH was significantly higher than that without LOH (tki-67 = 2.97, P = 0.0045; tPCNA = 2.93, P = 0.0051).

CONCLUSIONSLOH on chromosome 22 is a frequent event in the tumorigenesis of sporadic schwannoma. And, there is a correlation between LOH on chromosome 22 and proliferative activity in schwannoma. The frequency of LOH in vestibular schwannoma is significantly different from that in spinal schwannoma.

Adult ; Aged ; Cell Proliferation ; Chromosomes, Human, Pair 22 ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Loss of Heterozygosity ; Male ; Middle Aged ; Neurilemmoma ; genetics ; pathology ; Neuroma, Acoustic ; genetics ; Spinal Cord Neoplasms ; genetics ; Spinal Nerve Roots