Humans ; Histones/genetics* ; DNA Methylation ; Neurilemmoma/pathology* ; Central Nervous System Neoplasms/genetics*

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics

BACKGROUNDSchwannomatosis is a recently recognized peripheral nerve polyneoplasm with clinical characteristics and a genetic background that differ from those of neurofibromatosis 2 (NF2). The diagnostic and treatment criteria of this rare disorder are herein discussed.

METHODSThe data of 180 patients who underwent operations for benign schwannomas from 2003 to 2012 in our center were reviewed. Eight of them were classified as schwannomatosis according to the diagnostic criteria suggested by MacCollin. The demographic characteristics were documented and compared between the two groups of patients. The patients' clinical presentations, imaging characteristics, histological features, and treatment results were retrospectively investigated and summarized.

RESULTSOf the 180 cases of benign schwannomas we reviewed this time, eight patients presented with schwannomatosis (4.44%). The mean age of the two groups was not significantly different (40.0 vs. 44.7 years, t = 0.88, P = 0.378). However, schwannnomatosis seems to more generally occur in females (75% vs. 48% were females, P = 0.162), although the difference was not statistically significant. The initial main symptom was pain. The neurological examination was otherwise normal. Magnetic resonance imaging (MRI) revealed multiple discrete, well-defined round, or oval lesions distributed along the course of the peripheral nerves in the extremities with low-to-intermediate signal intensity on T1-weighted images and high-signal intensity on T2-weighted images. Vestibular schwannomas were excluded in four patients by cranial MRI. The lesions in all patients were resected and were pathologically proven to be schwannomas. The average follow-up period was 26 months. Six individuals obtained a good result without symptoms or function loss.

CONCLUSIONSSchwannomatosis is characterized by the development of multiple schwannomas without evidence of the vestibular tumors that are diagnostic for NF2. It commonly occurs in middle-aged females. It has similar demographic features to solitary benign schwannoma. Surgical resection always results in a good outcome.

Adult ; Female ; Follow-Up Studies ; Humans ; Magnetic Resonance Imaging ; Male ; Middle Aged ; Neurilemmoma ; genetics ; pathology ; surgery ; Neurofibromatoses ; genetics ; pathology ; surgery ; Skin Neoplasms ; genetics ; pathology ; surgery

The World Health Organization (WHO) classification of central nervous system (CNS) tumors incorporates morphology, cytogenetics, molecular genetics, and immunologic markers. Despite the relatively large number of CNS tumors with clonal chromosome abnormalities, only few studies have investigated cytogenetic abnormalities for CNS tumors in Korea. Thus, we investigated 119 CNS tumors by conventional G-banded karyotypes to characterize patterns of chromosomal abnormalities involving various CNS tumors, and 92.4% of them were cultured and karyotyped successfully. Totally, 51.8% of karyotypable CNS tumors showed abnormal cytogenetic results, including neuroepithelial tumors (75.0%), meningeal tumors (71.1%), pituitary adenomas (4.2%), schwannomas (44.4%), and metastatic tumors (100.0%). Glioblastomas had hyperdiploid, complex karyotypes, mainly involving chromosomes Y, 1, 2, 6, 7, 10, 12, 13, and 14. Monosomy 22 was observed in 56.4% of meningiomas. There was a significant increase in the frequencies of karyotypic complexity according to the increase of WHO grade between grades I and II (P=0.0422) or IV (P=0.0101). Abnormal karyotypes were more complex at high-grade tumors, suggesting that the karyotype reflects the biologic nature of the tumor. More detailed cytogenetic and molecular characterizations of CNS tumors contribute to better diagnostic criteria and deeper insights of tumorigenesis, eventually resulting in development of novel therapeutic strategies.
Adolescent ; Adult ; Aged ; Asian Continental Ancestry Group/*genetics ; Central Nervous System Neoplasms/classification/*genetics ; Child ; *Chromosome Aberrations ; Female ; Glioblastoma/genetics ; Humans ; Karyotyping ; Korea ; Male ; Meningeal Neoplasms/genetics ; Middle Aged ; Neurilemmoma/genetics ; Pituitary Neoplasms/genetics

The World Health Organization (WHO) classification of central nervous system (CNS) tumors incorporates morphology, cytogenetics, molecular genetics, and immunologic markers. Despite the relatively large number of CNS tumors with clonal chromosome abnormalities, only few studies have investigated cytogenetic abnormalities for CNS tumors in Korea. Thus, we investigated 119 CNS tumors by conventional G-banded karyotypes to characterize patterns of chromosomal abnormalities involving various CNS tumors, and 92.4% of them were cultured and karyotyped successfully. Totally, 51.8% of karyotypable CNS tumors showed abnormal cytogenetic results, including neuroepithelial tumors (75.0%), meningeal tumors (71.1%), pituitary adenomas (4.2%), schwannomas (44.4%), and metastatic tumors (100.0%). Glioblastomas had hyperdiploid, complex karyotypes, mainly involving chromosomes Y, 1, 2, 6, 7, 10, 12, 13, and 14. Monosomy 22 was observed in 56.4% of meningiomas. There was a significant increase in the frequencies of karyotypic complexity according to the increase of WHO grade between grades I and II (P=0.0422) or IV (P=0.0101). Abnormal karyotypes were more complex at high-grade tumors, suggesting that the karyotype reflects the biologic nature of the tumor. More detailed cytogenetic and molecular characterizations of CNS tumors contribute to better diagnostic criteria and deeper insights of tumorigenesis, eventually resulting in development of novel therapeutic strategies.
Adolescent ; Adult ; Aged ; Asian Continental Ancestry Group/*genetics ; Central Nervous System Neoplasms/classification/*genetics ; Child ; *Chromosome Aberrations ; Female ; Glioblastoma/genetics ; Humans ; Karyotyping ; Korea ; Male ; Meningeal Neoplasms/genetics ; Middle Aged ; Neurilemmoma/genetics ; Pituitary Neoplasms/genetics

BACKGROUNDSchwannoma is the tumor arising mainly from the cranial and spinal nerves. Bilateral vestibular schwannoma is the hallmark of neurofibromatosis type 2 (NF2). The NF2 gene has been cloned with comprehensive analysis of its mutations in schwannoma. However, most studies focused on vestibular schwannoma. There are differences in proliferation of tumor cell and ultrastructure between vestibular and spinal schwannomas. It is unknown whether genetic alterations in vestibular schwannoma are different from those in non-vestibular schwannoma. We analyzed the loss of heterozygosity (LOH) on chromosome 22 in patients with sporadic schwannoma including vestibular and spinal schwannomas and correlated this genetic alteration with tumor proliferation.

METHODSIn 54 unrelated patients without clinical NF1 or NF2, 36 patients had sporadic vestibular schwannoma, and 18 dorsal spinal root schwannoma. Four highly polymorphic linkage to NF2 gene microsatellite DNA markers (D22S264, D22S268, D22S280, CRYB2) were used to analyze LOH. The proliferative index was evaluated by Ki-67 and proliferative cell nuclear antigen (PCNA) immunostaining. Student's t test was used to analyze the difference of the proliferative index between schwannoma with LOH and that without LOH. The difference of the frequency of LOH in vestibular and spinal schwannomas was investigated by the chi-square test.

RESULTSTwenty-three schwannomas (42.6%, 23/54) showed allele loss. The frequency of LOH in vestibular schwannoma was significantly higher than that in spinal schwannoma (chi2 = 5.14, P < 0.05). The proliferative index of schwannoma with LOH was significantly higher than that without LOH (tki-67 = 2.97, P = 0.0045; tPCNA = 2.93, P = 0.0051).

CONCLUSIONSLOH on chromosome 22 is a frequent event in the tumorigenesis of sporadic schwannoma. And, there is a correlation between LOH on chromosome 22 and proliferative activity in schwannoma. The frequency of LOH in vestibular schwannoma is significantly different from that in spinal schwannoma.

Adult ; Aged ; Cell Proliferation ; Chromosomes, Human, Pair 22 ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Loss of Heterozygosity ; Male ; Middle Aged ; Neurilemmoma ; genetics ; pathology ; Neuroma, Acoustic ; genetics ; Spinal Cord Neoplasms ; genetics ; Spinal Nerve Roots

We identified Charcot-Marie-Tooth disease type 1A (CMT1A) in a family with schwannomas in the spinal cord and median nerve. The CMT1A in this family showed an autosomal dominant pattern, like other CMT patients with PMP22 duplication, and the family also indicated a possible genetic predisposition to schwannomas by 'mother-to-son' transmission. CMT1A is mainly caused by duplication of chromosome 17p11.2-p12 (PMP22 gene duplication). A schwannoma is a benign encapsulated tumor originating from a Schwann cell. A case of hereditary neuropathy with liability to pressure palsies (HNPP) concurrent with schwannoma has been previously reported. Although it seems that the co-occurrence of CMT1A and schwannomas in a family would be the result of independent events, we could not completely ignore the possibility that the coincidence of two diseases might be due to a shared genetic background.
Adolescent ; Adult ; Charcot-Marie-Tooth Disease/complications/*diagnosis/genetics ; Chromosomes, Human, Pair 17 ; Female ; Genetic Predisposition to Disease ; Humans ; Magnetic Resonance Imaging ; Male ; Median Neuropathy/*diagnosis/genetics ; Myelin Proteins/genetics ; Neurilemmoma/complications/*diagnosis/pathology ; Pedigree ; Peripheral Nervous System Neoplasms/*diagnosis/genetics ; Spinal Cord Neoplasms/*diagnosis/genetics

Antigens, CD34 ; metabolism ; Carcinoma, Signet Ring Cell ; genetics ; metabolism ; pathology ; surgery ; Codon ; Diagnosis, Differential ; Exons ; Female ; Follow-Up Studies ; Gastrectomy ; methods ; Gastrointestinal Neoplasms ; genetics ; metabolism ; pathology ; surgery ; Gastrointestinal Stromal Tumors ; genetics ; metabolism ; pathology ; surgery ; Humans ; Melanoma ; metabolism ; pathology ; Middle Aged ; Neurilemmoma ; metabolism ; pathology ; Point Mutation ; Proto-Oncogene Proteins c-kit ; metabolism ; Receptor, Platelet-Derived Growth Factor alpha ; genetics ; metabolism

OBJECTIVETo study the clinicopathologic features, immunophenotype, molecular genetics and differential diagnosis of solid variant of angiomatoid fibrous histocytoma.

METHODSThe clinicopathologic features of 3 cases of solid variant of angiomatoid fibrous histocytoma were analyzed and the literature was reviewed.

RESULTSThere were a total of 2 males and 1 female. The age of patients ranged from 9 to 12 years. The patients presented with a painless mass located in left forearm, left knee or back. The lesions were treated by complete surgical resection. On gross examination, the tumors varied from 1.6 cm to 4.5 cm in greatest dimension. They were well-circumscribed and had pale yellow to grayish-red solid cut surface. Histologically, the tumor was composed of histocytoid cells arranged in sheet-like pattern. A fibrous pseudocapsule surrounded by lymphocytes and plasma cells was identified. Immunohistochemical study showed that the tumor cells in all cases were positive for vimentin and CD68. They were negative for S100 protein, cytokeratin, CD34, CD31, smooth muscle actin, CD35, CD21 and CD30. Two cases also expressed CD99 and one of them was positive for desmin and epithelial membrane antigen. Fluorescence in-situ hybridization was positive for EWSR1 gene.

CONCLUSIONSSolid type represents a variant of angiomatoid fibrous histocytoma and is considered as tumor of borderline malignant potential. Definitive diagnosis requires thorough histologic examination and clinical correlation. Immunohistochemistry and EWSR1 gene study are helpful in further delineation and differential diagnosis. Complete resection or wide local excision with post-operative follow up is the main modality of treatment.

Antigens, CD ; metabolism ; Antigens, Differentiation, Myelomonocytic ; metabolism ; Back ; Calmodulin-Binding Proteins ; genetics ; Child ; Dendritic Cell Sarcoma, Follicular ; metabolism ; pathology ; Diagnosis, Differential ; Female ; Forearm ; Histiocytoma, Malignant Fibrous ; genetics ; metabolism ; pathology ; surgery ; Humans ; Knee ; Male ; Neoplasms, Muscle Tissue ; pathology ; Neurilemmoma ; metabolism ; pathology ; RNA-Binding Protein EWS ; RNA-Binding Proteins ; genetics ; Soft Tissue Neoplasms ; genetics ; metabolism ; pathology ; surgery ; Vimentin ; metabolism

OBJECTIVETo study the clinical and pathologic features of gastric schwannomas.

METHODSThe macroscopic and microscopic features of 9 cases of gastric schwannoma were analyzed. Immunohistochemical study for S-100 protein, CD117, CD34, neurofilament, desmin, nestin, glial fibrillary acidic protein, platelet derived growth factor-alpha (PDGFR-α) and vimentin was carried out. Mutation analysis of c-kit gene (exon 9, 11, 13 and 17) and PDGFR-α gene (exon 12 and 18) in 1 case was examined by PCR amplification and direct sequencing.

RESULTSThe patients included 5 males and 4 females. The age of patients ranged from 42 to 81 years (median = 56.5 years). The size of the tumors ranged from 2 to 9 cm in greatest diameter. Follow-up data in 8 cases (from 1 month to 65 months) showed no evidence of recurrence or metastasis. Gross examination showed that gastric schwannomas were homogeneous, firm, yellow-white and bore no true fibrous capsule. Histologically, all cases were composed of fascicles of spindle cells associated with nuclear palisading, Verocay body formation and peripheral cuff of reactive lymphoid aggregates. Some of them showed degenerative changes including cyst formation, calcification, hemorrhage, necrosis and hyalinization. Immunohistochemical study showed that the tumor cells were strongly positive for S-100 protein and vimentin. There was various degree of staining for nestin (8/9) and glial fibrillary acidic protein (6/9). They were negative for CD117, CD34, neurofilament, desmin and smooth muscle actin. One case showed focal positivity for PDGFR-α (1/9), with no mutations found.

CONCLUSIONSGastric schwannomas share similar histologic features with conventional soft tissue schwannomas, in addition to the presence a reactive lymphoid cuff. The clinical, macroscopic, histologic and immunohistochemical features of gastric schwannomas were different from those of gastrointestinal stromal tumors and leiomyomas.

Adult ; Aged ; Aged, 80 and over ; Diagnosis, Differential ; Exons ; Female ; Follow-Up Studies ; Gastrectomy ; methods ; Gastrointestinal Stromal Tumors ; metabolism ; pathology ; Glial Fibrillary Acidic Protein ; metabolism ; Humans ; Intermediate Filament Proteins ; metabolism ; Leiomyoma ; metabolism ; pathology ; Leiomyosarcoma ; metabolism ; pathology ; Male ; Middle Aged ; Mutation ; Nerve Tissue Proteins ; metabolism ; Nestin ; Neurilemmoma ; metabolism ; pathology ; surgery ; Neurofibroma ; metabolism ; pathology ; Receptor, Platelet-Derived Growth Factor alpha ; genetics ; metabolism ; S100 Proteins ; metabolism ; Stomach Neoplasms ; metabolism ; pathology ; surgery ; Vimentin ; metabolism