1.Development of Quantum Dot Submicrobeads-based Fluorescent Immunochromatographic Test Strip for Rapid Detection of Chloramphenicol
Qi Qiao DING ; Li LI ; Tao Wen FAN ; Nan Ya LYU ; Hua Jian HU ; Ping Li YAN ; Quan Su SONG
Chinese Journal of Analytical Chemistry 2017;45(11):1686-1693
A fluorescent immunochromatographic test strip based on the quantum dots submicrobeads (QBs) was developed for quantitative detection of chloramphenicol (CAP). In this method, monoclonal antibody of CAP and OBs complex fluorescent probe was first prepared using 1-ethyl-3-( 3-dimethylaminopropyl ) carbodiimide / N-hydroxysuccinimide coupling approach, then complete antigen CAP-HS-BSA was synthesized and sprayed on nitrocellulose membrane as test line (T line). Similarly, goat anti-mouse antibody was sprayed as control line (C line). The time required for the analysis was 15 min, and the limit of detection (LOD) for CAP was 0. 1 μg / L, with a working range of 0. 1 - 100 μg / L. In spiked milk samples, the test strip demonstrated high recoveries in the range from 93. 3% to 97. 9% with relative standard deviations of less than 7% .
2.Electrochemical Dopamine Sensor Based on Multi-Walled Carbon Nanotubes-Tungsten Oxide Nanocomposites
Hai-Ping HUANG ; Lian-Lian LYU ; Zhong-Zhen CHEN ; Ya-Nan CHEN ; Li-Ping WANG ; Ying CHEN
Chinese Journal of Analytical Chemistry 2018;46(5):765-772
Multi-walled carbon nanotubes-tungsten oxide (MWCNTs-WOx) nanocomposites were fabricated on glassy carbon electrode (GCE) through a simple electrodeposition method,in which WOx were fabricated on MWCNTs. The morphology and constitution were characterized by field emission scanning electron microscopy(SEM) and X-ray photoelectron spectroscopy(XPS). Electrochemical characterization of modified electrode was done by electrochemical impedance spectroscopy (EIS). The cyclic voltammogram (CV)method was adopted to investigate the electrochemical behavior of dopamine (DA) on MWCNTs-WOx-modified glassy carbon electrode, and a new detection method for DA was developed by differential pulse voltammetry (DPV). The results showed that MWCNTs-WOx nanocomposites had obvious electrocatalytic effect on DA in phosphate buffer solution (pH=6.5). Under the optimized experimental conditions, the DA peak current demonstrated a good linear relationship with concentration in the range of 0.05-1.00 mmol/L, and the detection limit was 17 μmol/L(S/N=3). Effects of different experimental parameters on the response current of the modified electrode were investigated,and it was found that the prepared electrochemical sensor displayed good reproducibility,high selectivity and strong anti-interference ability. UA did not interfere with the detection of DA. A new electrochemical method for the quantitative determination of DA was established and successfully applied to the determination of dopamine hydrochloride injection samples.
3.Ethambutol optic neuropathy
International Eye Science 2019;19(2):240-243
Ethambutol(EMB)has been used as first-line antibiotics to treat tuberculosis. Side effects of ethambutol have been well documented since its original use, with the most serious one being optic neuropathy. EMB-induced optic neuropathy(EON)may be reversible in the early stages, but delayed diagnosis has been shown to result in permanent visual loss. Thus the reversibility of EON is dependent on early detection. In this review, we discuss risk factors, detection methods, treatment and prevention of EON.
4.Variant analysis of CCBE1 gene in a case of Hennekam lymphangiectasia-lymphedema syndrome type 1.
Ying REN ; Yi LIU ; Yuqiang LYU ; Min GAO ; Dong WANG ; Ya WAN ; Jian MA ; Nan SHEN ; Zhongtao GAI
Chinese Journal of Medical Genetics 2020;37(6):669-672
OBJECTIVE:
To explore the genetic etiology of a child with lymphangiectasia and lymphedema.
METHODS:
DNA sample of the patient was extracted and subjected to whole exome sequencing. Suspected variants were verified by Sanger sequencing.
RESULTS:
The patient was found to carry compound heterozygote variants (c.521G>A and c.472C>T) of the CCBE1 gene, which were respectively inherited from his parents.
CONCLUSION
The compound heterozygote variants of the CCBE1 gene probably underlie the disease in this child.
5.Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4
Tingting YANG ; Shuzhen MA ; Ling LYU ; Yuan CHEN ; Ya′nan ZHANG ; Xinli BAI
Chinese Journal of Applied Clinical Pediatrics 2023;38(6):457-460
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
6.Analysis of PRX gene variants in a child with Charcot-Marie-Tooth disease type 4F
Ya′nan YANG ; Shuxin YE ; Yuqiang LYU ; Hongmei XIN ; Min GAO ; Jian MA ; Dong WANG ; Zhongtao GAI ; Yi LIU
Chinese Journal of Medical Genetics 2022;39(7):749-753
Objective:To explore the genetic etiology of a child suspected for peroneal muscular atrophy.Methods:The child and his parents were analyzed by using next generation sequencing.Results:The child was found to harbor compound heterozygous variants of c. 52G>T (p.Glu18X) and c. 1390C>T (p.Arg464X) of the PRX gene, which were inherited from his father and mother, respectively. Among these, the c. 52G>T variant was previously unreported. Based on the standards and guidelines of the American College of Medical Genetics and Genomics, both variants were predicted to be pathogenic (PVS1+ PM2+ PM3, PVS1+ PM3-Strong+ PM2+ BS2). Conclusion:The compound heterozygous variants of the PRX gene probably underlay the Charcot-Marie-Tooth disease type 4F in this child. Above finding has enriched the mutational spectrum of the PRX gene.
7.Clinical and genetic analysis of a child with Canavan disease due to compound heterozygous variants of ASPA gene
Shasha NIU ; Yanyan MA ; Yuqiang LYU ; Hongmei XIN ; Dong WANG ; Yanxin WANG ; Ya′nan YANG ; Zilong LI ; Yi LIU ; Zhongtao GAI
Chinese Journal of Medical Genetics 2024;41(2):225-229
Objective:To analyze the clinical phenotype and genetic characteristics for a child with Canavan disease.Methods:A child who was admitted to the Children's Hospital Affiliated to Shandong University on April 9, 2021 for inability to uphold his head for 2 months and increased muscle tone for one week was subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.Results:Genetic testing revealed that the child has harbored compound heterozygous variants of the ASPA gene, including a paternally derived c. 556_559dupGTTC (p. L187Rfs*5) and a maternally derived c.919delA (p. S307Vfs*24). Based on the guidelines from the American College of Medical Genetics and Genomics, both variants were predicted to be pathogenic (PVS1+ PM2_Supporting+ PM3). Conclusion:The c. 556_559dupGTTC (p.L187Rfs*5) and c. 919delA (p.S307Vfs*24) compound heterozygous variants of the ASPA gene probably underlay the pathogenesis of Canavan disease in this child.
8. Advances in research on drug-induced ovarian developmental toxicity and mechanism
Jing HUANG ; Yi LIU ; Jing HUANG ; Ya-Wen CHEN ; Hui WANG ; Feng LYU
Chinese Pharmacological Bulletin 2022;38(7):970-974
Improper use of drugs during pregnancy ( such as en¬docrine and nervous system dnjgs) can cause fetal ovarian de¬velopmental toxicity, which induces premature ovarian failure and other related diseases susceptible in adulthood.'Hie mecha¬nism of ovarian developmental toxicity mainly involves abnormal epigenetic modification during fetal period, oxidative stress inju¬ry, intrauterine neuroendocrine development programming, etc.In this paper, the ovarian developmental toxicity and intrauterine programming mechanism of offspring induced by pregnancy med¬ication are systematically reviewed to provide evidence for the prevention and control of ovary-related diseases.
9.Study on discovery of efficacy markers for Dachaihu Decoction and its action mechanism.
Ya-Nan LIU ; Tian-Yi LYU ; Yue REN ; Yu-Bin XU ; Yuan ZHANG ; Sheng-Li WEI ; Yan-Ling ZHANG
China Journal of Chinese Materia Medica 2022;47(8):2200-2210
Dachaihu Decoction is a classical Chinese herbal prescription that is effective in harmonizing lesser yang and purging internal accumulated heat. At present, it has been widely used in clinical practice, and the resulting outcomes are satisfactory. However, its quality indicators and action mechanism are still not clear. Therefore, this paper explored the efficacy markers of Dachaihu Decoction and its action mechanism based on literature mining, molecular biology, and network pharmacology, so as to better control its quality and ensure its clinical efficacy. The efficacy markers of Dachaihu Decoction were predicted and analyzed according to the "five principles" for Q-markers of Chinese herbs. Then the anti-inflammatory activity of the efficacy markers of Dachaihu Decoction was evaluated with Griess reagent after the establishment of RAW264.7 cell inflammation model in vitro with lipopolysaccharide(LPS). The potential targets of efficacy markers were predicted by Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform(TCMSP), ChEMBL, and SwissTargetPrediction, followed by the construction of the protein-protein interaction(PPI) network of the efficacy markers of Dachaihu Decoction. Topological, GO, and KEGG enrichment analysis was carried out to construct the "key target-signaling pathway-biological process" network, thus elucidating the action mechanism of the efficacy markers of Dachaihu Decoction. Saikosaponin B_2, baicalin, baicalein, wogonoside, neohesperidin, naringin, hesperidin, and paeoniflorin were considered as the potential efficacy markers of Dachaihu Decoction. The anti-inflammatory activity evaluation showed that the potential efficacy markers effectively inhibited the release of NO, exhibiting good anti-inflammatory activities. As demonstrated by network pharmacology, the efficacy markers of Dachaihu Decoction regulated the inflammatory response by acting on MAPK and NF-κB signaling pathways, the carbohydrate metabolism by HIF-1 and PI3 K-AKT signaling pathways, and the lipid metabolism by AMPK and PI3 K-AKT signaling pathways. This study discovered the efficacy markers of Dachaihu Decoction based on literature mining combined with molecular biological experiments and explored its action mechanism at the molecular level based on network pharmacology, which would provide reference for the quality control of Dachaihu Decoction and scientific basis for its clinical application.
Biomarkers
;
Drugs, Chinese Herbal/pharmacology*
;
Medicine, Chinese Traditional
;
Molecular Docking Simulation
;
Proto-Oncogene Proteins c-akt
;
Signal Transduction