1.Observations of comprehensive interventions and alprazolam therapy for insomnia
Yong CHEN ; Murong YE ; Lijuan ZU ; Chuyan WU
Chinese Journal of General Practitioners 2015;14(6):448-450
A total of 100 insomniacs were randomly divided into intervention and contrast groups (n=50 each).The contrast group took only alprazolam while the intervention group received both alprazolam and other comprehensive regimens,including acupuncture,psychotherapy and traditional Chinese medicine.One course of treatment lasted 10 days for both groups and 6 courses were offered.After comprehensive interventions,as compared with contrast group,the scores of Pittsburgh Sleep Quality Index (PSQI) and Athens Insomnia Scale (AIS) decreased obviously in intervention group (P < 0.05).And the curative rate (46%) and the total efficacious rate (96%) of intervention group were higher than those of contrast group (P < 0.05).
2.Investigation of survival motor neuron gene deletion in Chinese patients with sporadic amyotrophic lateral sclerosis
Zongquan SU ; Shirui GAN ; Zhiying WU ; Wanjin CHEN ; Yan CHEN ; Ning WANG ; Shenxing MURONG ; Chuanzhen Lü
Chinese Journal of Neurology 2009;42(4):245-247
Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.
3.Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative
Qifang LIN ; Wanjin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2011;44(8):568-573
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.
4.Detection mitochondrial DNA A3243G mutation loads by the real-time amplification refractory mutation system quantitative polymerase chain reaction
Xiaozhen LIN ; Wanfin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2009;42(3):197-200
Objective To evaluate the quantitative technique of real-time amplification refractory mutation system quantitative PCR( RT ARMS-qPCR)in the detection of the mitochondrial DNA A3243G mutation load.To investigate the mutation load in different tissues in patients with mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS).Methods Wild type and mutant-type (A3243G) of mitochondrial DNA were cloned into plasmid pMD18-T to construct express vectors. Thirteen standard controls having different proportions of mutation loads were developed by mixing wild-type and mutant-type cloned plasmid DNA in different ratios. The mutation loads in the tissues of blood, muscle, hair follicles and urine from seven patients with MELAS and one carrier, and blood samples in 53 unaffected subjects were detected by lit ARMS-qPCR and PCR-RFLP. ResultsIn standard controls, there was a linear correlation between the expected values and results of mutation loads detected by both methods of PCR-RFLP (R21 = 0. 885 ) and RT ARMS-qPCR (R22 = 0. 991 ) . The results detected by RT ARMS-qPCR were closer to the expected values. The detection of mutation loads in tissues from the patients revealed higher values by liT ARMS-qPCR method than by PCR-RFLP and RT ARMS-qPCR was more sensitive in detecting the lower A3243G mutation load. The mutation load in muscle, hair follicles or urinary sedimem is higher than that in leukoeytas.Conclusion The RT ARMS-qPCR provides a convenient,rapid, sensitive and reliable quantitative detection of heteroplasmic mutant mtDNA A3243G in different tissues.
5.Mutation analysis of senataxin gene in sporadic amyotrophic lateral sclerosis
Huiling XIONG ; Wenzu CHEN ; Zhiying WU ; Zhenhua ZHAO ; Ning WANG ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2010;43(2):90-92
Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.
6.Effect of madecassoside on depression behavior of mice and activities of MAO in different brain regions of rats
Murong LIU ; Ting HAN ; Yao CHEN ; Luping QIN ; Hanchen ZHENG ; Yaocheng RUI
Journal of Integrative Medicine 2004;2(6):440-4
OBJECTIVE: To evaluate the effects of madecassoside (MC) on the depression behavior of mice and the activities of monoamine oxidase (MAO) in different rat brain regions. METHODS: Imipramine as the positive contrast medicine, effects of MC on the depression behavior of mice were observed by forced swimming test and reserpine antagonist test. Moclobemide and pargyline as the positive controlled medicines, the activities of monoamine oxidase-A (MAO-A) and monoamine oxidase-B (MAO-B) in different rat brain regions were determined after intragastric administration of MC in 3 different dosages for 3 days or 21 days. RESULTS: (1) The low, middle and high dosages of MC (i.g.) significantly reduced the immobility time of mice in forced swimming test (P<0.05). (2) MC in dosages of 10 mg/kg and 20 mg/kg prevented the lowering of temperature induced by reserpine (P<0.05), while 40 mg/kg had no significant effects on it (P>0.05). (3) With acute administration (3 days), the low, middle and high dosagey of MC (i.g.) significantly inhibited the activity of MAO-A in hippocampus (P<0.01), and the high dosage significantly inhibited the activity of MAO-A in hypothalamus (P<0.01), while the 3 dosages had no significant effects on the activity of MAO-A in cortex (P>0.05). With chronic administration (21 days), MC in 3 dosages had no significant effects on the activities of MAO-A in cortex and hypothalamus (P>0.05), and the high dosage (40 mg/kg) significantly enhanced the activity of MAO-A in hippocampus (P<0.01). (4) With acute administration, MC in dosages of 10 mg/kg and 20 mg/kg significantly inhibited the activity of MAO-B in cortex (P>0.05), and MC in dosage of 10 mg/kg significantly inhibited the activity of MAO-B in hypothalamus (P<0.05), and MC in dosage of 20 mg/kg significantly enhanced the activity of MAO-B in hippocampus (P<0.01). With chronic administration, MC of 3 dosages produced no significant effects on the activities of MAO-B in 3 different rat brain regions (P>0.05). CONCLUSION: These results support the idea that MC produces antidepressant effects through MAO inhibition in rat brain, which seems stronger with acute administration than chronic administration, while its mechanism remains to be further studied.
7.Protective effect of Xiaoyan Lidan Tablet on acute hepatic injury in rats
Murong YE ; Yukiko NAGAO ; Chuyuan LI ; Deqin WANG ; Jiannan CHEN ; Xiaoping LAI
Chinese Traditional Patent Medicine 1992;0(11):-
AIM: To study the protective effects of Xiaoyan Lidan Tablet(Herba Andrographis,Herba Rabdosiae serrae,Radix Sophorae Flavescentis,etc) on acute hepatic injury in rats. METHODS: Acute hepatic injury was induced by intraperitoneal(ip) injection of carbon tetrachloride and D-galactosamine,respectively.The levels of ALT,AST,ALP,TBA,total bilirubin(T-Bil),total protein (TP) and albumin(ALB) in serum were analyzed.The body weight,liver weight,spleen weight and thymus weight of each rat were measured.The hepatic glycogen content was analyzed individually.Liver tissue pathology was observed. RESULTS: Xiayan Lidan Tablet can decrease ALT,AST,ALP,TBA and T-Bil in serum,reduce necrosis in pathological observation. CONCLUSION: Xiaoyan Lidan Tablet gives the protective effects to acute hepatic injury induced by CCl_4 and D-Gal in rats.
8.Experimental Study on Stability of Pelvic Ring Reconstruction Using Fibular Autograft for Periacetabular Tumor Type Ⅱ Resection
Murong YOU ; Guangtong YU ; Yongwei JIA ; Zhizhen JING ; Bing LI ; Bo CHEN ; Zuquan DING
Chinese Journal of Rehabilitation Theory and Practice 2009;15(1):48-50
Objective To evaluate the stability of the pelvic ring reconstruction using fibular autograft for periacetabular tumor type Ⅱ resection. Methods 6 adult cadaveric specimens were tested. The periacetabular tumor resection models were established according to Ennecking's type Ⅱ resection. The resected pelvic rings were reconstructed with double-fibular graft fixed by four internal fixation techniques including plates, pedicle-rods (PR), lateral-rods (LR) or sacral-iliac rods (SIR). Axial loading from the proximal L3 vertebral body was applied by MTS load cell in the gradient of 0~500 N in the double feet standing state. Images in front view were obtained using CCD camera. Based on Image J software, displacement of the first sacral vertebrae (S1) of the reconstructed pelvis and intact pelvis were calculated using digital maker tracing method with center-of-mass algorithm. Results The rotational movements and vertical displacement of S1 around the normal side femoral head of the reconstructed pelvis in coronary plane were found in simulated bilateral leg standing position. The average vertical load-displacement and load-angular rotation curve of S1 in coronary plane were approximately linear behavior under the vertical load 500 N. The average vertical displacement and angle of S1 in coronary plane had not overacted. The stability of axial direction and rotation had not changed significantly when reconstructed by LR or Plates compared with the intact pelvis, but the SIR did. Conclusion Plates and LR fixation were more stabile for periacetabular tumor type Ⅱ resection.
9.Optimization of short tandem repeats and their application in prenatal diagnosis of spinal muscular atrophy
Jun-Fen SU ; Wan-Jin CHEN ; Zhi-Ying WU ; Ning WANG ; Yu LIN ; Min-Ting LIN ; Shenxing MURONG ;
Chinese Journal of Neurology 2005;0(07):-
Objective To optimize the short tandem repeats(STR)which link closely to survival motor neuron(SMN)and have redundant polymorphism information contents,and to use these STR in the prenatal diagnosis of spinal muscular atrophy(SMA).Methods Eleven STR loci(D5S435,D5F153, DSF151,D5S637,D5S1413,D5S125,D5S464,D5S1556,DSF149,D5S351,MAP1B-5')were amplified by PCR.Then the PCR products were detected by polyacrylamide gel electrophoresis(PAGE)and analyzed by silver staining.STR loci were evaluated and optimized by their PIC values.PCR-PAGE and gene scan were combined to make genetic link analysis for SMA families based on the optimized STR.Results Three STR loci(D5S435,DSF149 and D5S351)were selected with 8,19 and 18 polymorphic fragments detected respectively in 100 normal individuals.Their PIC values were 0.84,0.91 and 0.92 respectively.Four carriers and 2 normal individuals were detected from 6 SMA families with linkage analysis by using the 3 STR.Conclusion This genetic diagnosis system based on the 3 STR loci can provide rapid prenatal diagnosis for SMA families,can eliminate maternal blood contamination,and also can discriminate carriers from normal individuals in the fetuses,which makes the prenatal diagnosis system of SMA perfect.
10.Preparation of polyclonal antibody against survival motor neuron protein and study on the expression of survival motor neuron protein in the skeletal muscular of patients with spinal muscular atrophy
Wan-Fin CHEN ; Zhi-Ying WU ; Ning WANG ; Jun-Feng SU ; Min-Ting LIN ; Shen-Xing MURONG ;
Chinese Journal of Neurology 2005;0(12):-
Objective To prepare the survival motor neuron(SMN)polyclonal antibody and explore the localization of SMN protein in transfected cells and its expression in skeletal muscles of patients with spinal muscular atrophy(SMA).Methods A prokaryotic expressional plasmid named pET-28? (+)/SMN was constructed and SMN-His fusion protein was induced.The fusion protein was used to immunize New Zealadd rabbits to prepare SMN polyclonal antibody.A eukaryotic expressional plasmid named pcDNA3.1/myc-HisB-SMN was constructed and used to transfect CHO cells.Skeletal muscles were collected from 3 patients with bone fracture who were regarded as normal controls, and 3 SMA patients of type Ⅰ, 3 of type Ⅱ and 3 of type Ⅲ who were ascertained by genetic analysis.Western-blotting and immunofluorescence stain were applied to study the expression of SMN in transfected CHO cells and skeletal muscles of normal individuals and SMA patients.Results Correct pET-28a(+)/SMN prokaryotic expressive plasmid was constructed and SMN-His fusion protein was obtained from E coli BL21 transformed with pET-28a(+)/SMN.Then, rabbit anti-human full-length SMN polyclonal antibody of high specificity and sensitivity was obtained from rabbits immunized by SMN-His fusion protein.SMN proteins were shown diffusedly locating in the cytoplasm and nucleus of CHO cells transfected with pcDNA3.1/myc-HisB-SMN plasmid and mainly accumulating around the nucleus.The results of Western-blotting were as follows:the average ratio of SMN band density to glyceraldehyde phosphate dehydrogenase(GAPDH)band density (SMN/GAPDH)is 0.619 in skeletal muscles from normal controls, the average values of SMN/GAPDH in skeletal muscle from SMA patients of type Ⅲ and Ⅱ were 0.347 and 0.340 respectively, which were lower than that of normal controls.However, the average values of SMN/GAPDH in skeletal muscle from SMA patients of type I was only 0.079, which was quite lower than that of normal controls.Conclusions The rabbit anti-human full-length SMN polyclonal antibody is of high specificity and sensitivity, which makes the basis for the research of SMN function and SMA pathogenesis.There may be a correlation between the SMN level in skeletal muscle and the severity of disease.