Neurofibromatosis type 1 (NF1) presents with a diverse range of symptoms that can affect the skin, bones, eyes, central nervous system, and other organs. This article reports the diagnosis and treatment process of a patient with NF1 complicated by bilateral severe-to-profound sensorineural hearing loss. Genetic testing revealed a heterozygous variant of NF1 NM_ 000267.3: c.4054_ 4058del(p.Ser1352LeufsTer20, supporting the diagnosis of NF1. After thorough evaluation, a right cochlear implantation was performed, yielding satisfactory postoperative results. This case suggests that NF1 patients may exhibit phenotypic heterogeneity and atypicality, providing a reference for clinicians in the diagnosis and treatment of such patients.

Objective To track and evaluate the implementation and application of the occupational health standard Radiation shielding requirements for radiotherapy room—Part 4: Radiotherapy room of ²⁵²Cf neutron afterloading (GBZ/T 201.4-2015) by radiation health technical service agencies, medical institutions, health supervision agencies, and radiotherapy facility design units, and to provide a scientific basis for the further revision and implementation of this standard. Methods Following the Guideline for health standards tracking evaluation (WS/T 536-2017) and the project implementation plan, relevant practitioners were randomly selected for a questionnaire survey. The survey primarily focused on their awareness, standard training, application, and revision suggestions of GBZ/T 201.4-2015. The results were summarized and analyzed. Results A total of 168 evaluation questionnaires were collected from relevant practitioners in 28 provinces. Only 31.6% of the respondents reported being “well familiar” or “ familiar” with the standard, 27.4% of the respondents believed that the standard was widely used, and 45.2% of the respondents believed that the standard could meet the needs of their work. Only 14.9% of the respondents had received relevant training on the standard, more than half of the respondents had not applied the standard within the past 10 years, and 45.2% of the respondents believed that the standard "needs to be revised". Conclusion Due to the small number of californium-252 neutron afterloading radiotherapy devices in operation on the market, the overall awareness of the standard is low, suggesting that relevant authorities need to strengthen training and publicity of the standard, and that certain sections of the standard need to be revised or merged.

Glycogen storage disease type Ⅰb（GSD Ⅰb）is an autosomal recessive genetic disease characterized by abnormal glycogen metabolism.The clinical manifestations include signs of metabolic abnormality of the typical GSD I，and the patients with GSD Ⅰb also have neutropenia and symptoms including recurrent infection，oral and intestinal mucosal ulcers，inflammatory bowel diseases and autoimmune thyroiditis.However，the detailed mechanism of GSD Ⅰb has not been clarified.Treatment with sodium-dependent glucose transporters 2（SGLT2）inhibitors improves both neutropenia and neutrophil function through reducing 1，5-anhydroglucitol（1，5-AG）in plasma，as well as alleviates the related clinical symptoms，so SGLT2 inhibitors are increasingly used in the treatment of GSD Ⅰb.Here it reviews the neutropenia mechanism and recent advances in animal-based research and clinical application of SGLT2 inhibitor therapy for GSD Ⅰb.

Objective To investigate the clinical characteristics of the hepatolenticular degeneration in children,and to clarify the significance of gene diagnosis in children with hepatolenticular degeneration.Methods A total of 75 patients with hepatolenticular degeneration were enrolled in the Department of Pediatrics,Peking Union Medical College Hospital from 2011 to 2018.All of them carried out a generation of gene sequencing for ATPase Cu2+trans-porting beta polypeptide(ATP7B)gene and multiplex ligation-dependent probe amplification(MLPA)analysis.Results Among the 75 pediatric patients,55 patients were asymptomatic and had elevated aminotransferases as the incidental findings.All the pediatric patients had decreased ceruloplasmin.Seventy-two of pediatric patients had 24-hour urinary copper＞40 μg/d.There were 16 cases that had Kayser-Fleischer(K-F)rings.Sixteen six out of 75(21.33%)cases were diagnosed clinically and 15 cases were＞7 years old.All the remaining patients needed genetic diagnosis.Sixty-six patients had two mutations and 9 patients had only one mutation,1 had no mutation.Forty eight different mutations were found to be localized in ATP7B gene.These mutations included 32 missense mutations,6 splice mutations,5 deletion mutations,2 repeated mutations,2 insert mutations and 1 nonsense muta-tions.The most frequently three mutations were c.2333G＞T,p.R778L,c.2621C＞T,p.A874V,c.2975C＞T,p.P992L,whose allele frequencies were 30.49%,14.89%,9.92%.Conclusions The research showed that in young aged patients,the nervous system symptoms are not obvious and the positive rate of laboratory tests are lower than adults so is a challenge to clinical diagnosis.So Genetic testing is of great significance for the early diagnosis and early treatment of disease in pediatric patients.

Objective:To investigate the safety, efficacy and effective dose of empagliflozin in the treatment of glycogen storage disease type Ⅰb (GSD Ⅰb).Method:This was a cross sectional study. A total of 28 children with GSDⅠb who started oral empagliflozin treatment from January 2021 to June 2023 in the WeChat group of patients with glycogen storage disease were selected as the study objects. Clinical data such as general situation, current situation of medication and adverse reactions of the children were collected through questionnaires from June 18 to 30, 2023. The differences of symptoms and laboratory tests before and after empagliflozin treatment were compared by using paired chi-square test and Wilcoxon signed rank sum test.Results:Totally 28 children with GSD Ⅰb were from 12 different provinces, autonomous regions and municipalities in China. There were 14 males and 14 females. Empagliflozin treatment was started at the age of 4.8 (2.4, 10.8) years, the time of treatment was 14.5 (11.3, 21.5) months, the initial dosage was (0.23±0.11) mg/(kg·d), and the maintenance dosage was (0.28±0.12) mg/(kg·d). Empagliflozin showed positive effects on neutropenia, severity of inflammatory bowel disease like symptoms( Z=-3.70 , -2.65, both P<0.05), The proportion of recurrent oral ulcers, recurrent bacterial infections and anemia was significantly lower than that before medication (18% (5/28) vs. 46% (13/28), 14% (4/28) vs. 46% (13/28), 21% (6/28) vs. 46% (13/28), χ2=4.05, 5.26, 3.05 , all P<0.05). Granulocyte colony-stimulating factor (GCSF) was once used in 5 children with GSD Ⅰb, all of them had completely stopped GCSF after empagliflozin treatment. The most common adverse events during empagliflozin treatment were hypoglycemia (5 children) and urinary infection (3 children). All 28 patients had no serious adverse reactions. Conclusions:Empagliflozin can increase the neutrophil count of children with GSD Ⅰb, and had a favorable effect on symptoms such as recurrent oral ulcers, and recurrent infection. The common adverse events during empagliflozin treatment were hypoglycemia and urinary infection.

Objective:To summarize the clinical phenotype and genetic characteristics of deficiency in ELF4 gene X-linked (DEX).Methods:A case series study was conducted to retrospectively analyze the clinical data and genetic testing results of 2 cases of DEX treated at Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and the First Hospital of Jilin University from January 2023 to April 2024. And literature up to April 2024 was searched from the PubMed database, as well as CNKI and Wanfang databases, using keywords such as "ELF4 deficiency" "deficiency in ELF4, X-linked""ELF4 gene". The main clinical manifestations and genotypes of DEX were summarized.Results:Both patients were male, with onset ages of 3 months and 3 years, respectively. Both patients presented with recurrent oral ulcers and abdominal pain. And the laboratory examination showed a significant increase in inflammatory markers. Intestinal examinations showed multiple intestinal ulcers, and both patients developed intestinal fistulas. Whole exome sequencing found ELF4 c.799C>T, p Arg267Trp and ELF4 c. 248-7G>A, both maternal variants. Based on clinical and genetic results, DEX were diagnosed. In terms of treatment, both patients underwent surgical treatment during the acute phase of the disease and received anti-tumor necrosis factor α therapy, but recurrent gastrointestinal symptoms were still observed in Patient 1, while the clinical effect in Patient 2 was still acceptable. However, the inflammatory markers in both patients were not normal even after treatment. Literature review found 18 patients including 2 patients in this study, reported in 5 English articles and no Chinese reports. Thirteen patients had disease onset age before 5. The main clinical manifestations were fever (12/17), oral ulcers (14/18), abdominal pain (8/18), diarrhea (6/18), perianal ulcers (5/17), ileum ulcers (6/16), colon ulcers (7/16), skin involvement (7/17) and recurrent infections (7/18); laboratory examinations found increased erythrocyte sedimentation rate (13/15) as well as C-reactive protein (9/9), and anemia (13/15); in terms of immunological function, there is a decrease in natural killer cells (9/15) as well as a decrease in class switching memory B cells (8/9). The main types of gene variantions were missense variantions (6/18), nonsense variantions (4/18) or frameshift variantions (3/18).Conclusions:DEX should be considered when an early-onset male patient manifested with recurrent fever, oral ulcers or mucosal ulcers, with elevated inflammatory markers, with or without recurrent infection. It is recommended to perform lymphocyte subsets analysis, gastrointestinal endoscopy and genetic testing to support the diagnosis.

Prader-Willi syndrome(PWS)is a genetically imprinted disorder characterized by intellec-tual impairment,obesity,metabolic disorders,and behavioral abnormalities.The pathological mechanisms of metabolic disorders and behavioral abnormalities are not yet clear,and the treatment effect up to now is not satisfactory.In recent years,the role of gut microbiota in metabolic regulation has gradually been recognized.This article will systematically review the research progress of gut microbiota in PWS.Compared to healthy in-dividuals or other simply obese individuals.PWS patients show changes in the gut microbiota.The changes are related to metabolic disorders and inflammatory status in PWS patients.Intervention of gut microbiota through diet or probiotics has played a certain role in controlling weight and improving behavioral abnormalities in PWS patients.

Schimke immuno-osseous dysplasia (SIOD)caused by SMARCAL1 gene mutations is a rare genetic disorder characterized by multi-system involvement, including T-cell dysfunction, skeletal dysplasia, disproportionate short stature, nephrotic syndrome, and kidney failure. This multidisciplinary consultation involved a 9-year-old boy with intrauterine growth retardation, presenting with short stature, T-cell lymphopenia, proteinuria, and degenerative bone and joint disease. Treatment primarily focused on symptomatic and supportive care. Through the multidisciplinary rare disease consultation, holistic support was provided to the patient, offering comprehensive care from various specialtiesx.We also aim to use this case report to enhance clinicians′ under-standing of SIOD and improve the management and treatment of rare diseases.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Glycogen storage diseases (GSDs)refer to a group of metabolic disorders caused by congenital enzyme deficiencies. This group of diseases are characterized by abnormal glycogen metabolism. Most subtypes can lead to increased glycogen accumulation in tissues of the liver, muscles, kidneys etc. GSD type Ⅰ (GSDⅠ) is the most common type of the liver glycogen storage diseases that are caused by a deficiency in glucose-6-phosphatase in the liver, kidneys, and intestines. This typle has two subtypes: type Ⅰa and type Ⅰb(GSDⅠb). Recently, research into the molecular mechanisms of GSD Ⅰb made further progress, leading to significant improvements in clinical diagnosis and the new treatment methods based on the pathogenesis. This article summarizes the current research status of diagnosis and screening, molecular genetic mechanisms, and treatment of GSD Ⅰb. The article also points out the opportunities, the challenges and future possibilities.