Objective By exploring the effects of recombinant human bone morphogenetic protein (rhBMP)2 and rhBMP13 on chondrocytes proteoglycan production and phenotype expression to establish the theoritical mechanisms for the treatment of disc degeneration with chondrocytes transplantation plus BMPs.Methods The dose-dependent effects of rhBMP2 and rhBMP13 on PG protein synthesis and gene expression were detected under different concentrations (0,25,125,and 625 ng/ml).The sulfated-glycosaminoglycan (s-GAG) in the culture media and the pericellular matrix was measured with a 1,9-dimethyl-methylene blue (DMMB) colorimetric assay.Reverse transcriptase polymerase chain reaction (RT-PCR) was performed respectively to quantify the relative abundance of aggrecan Mrna.Cell proliferation was examined by Hoechst Dye assay.Results All rhBMP2 and rhBMP13 in different concentrations could significantly increase s-GAG synthesis and gene expression in chondrocytes (P＜0.05).And at the same concentration.rhBMP2 was more potent than rhBMP13 on s-GAG synthesis.Hoechst Dye assay showed neither rhBMP2 nor rhBMP13 had significant effect on cell proliferation.Conclusion rhBMP2 and rhBMP13 are able to upregulate s-GAG synthesis,in addition,rhBMP2 is more potent than rhBMP13 on aggrecan gene expression regulation,but rhBMP2 and rhBMP13 do not have significant effect on chondrocyte proliferation.

[Objective] To evaluate the diagnostic values of multi-detector spiral computed tomography (MDCT) in pediatric sacrococcygeal tumors (SCT) and to improve the diagnostic ability.[Methods] 54 children (22 male and 32 female,age between 1 day and 16 years old) with pathologically confirmed SCT were involved in our study.All of them received 64-row spiral Computed Tomography before surgery,CT characteristics and clinical data were retrospectively analyzed.[Results] Pediatric SCT are more common in female children under four years old,with the germ cell tumors most common,followed by neurogenic tumors.Among the 54 SCT,39cases were malignant and 15 were benign (malignant∶ benign =2.60∶1).In CT image findings,37 cases (68％) were mainly solid mass,with 31 cases confirmed malignant by pathology.8 cases (15％) were mainly cystic,with all of them confirmed benign by pathology.9 cases (17％) were cystic-solid or with obvious necrosis in solid mass,with 8 cases confirmed malignant by pathology.[Conclusion] Malignant pediatric SCT are more common than benign SCT.Most malignant SCT are mainly solid mass or cystic-solid or with obvious necrosis in solid mass,and most benign tumors are mainly cystic.Combined with clinical data,MDCT can help to correctly diagnose SCT before surgery.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Diagnostic Imaging Pediatric bone and joint system was a sub-branch of professional courses.The content was more difficult and learners were not relaxed to master the knowledge alone.It was easy,across time and space,resource sharing and interactive to operate on blackboard teaching platform.We can better accomplish teaching and learning task with pediatric bone and joint diagnostic imaging online course constructed by blackboard platform.

Organ transplantation is an effective treatment for end-stage organ failure. The shortage of donors severely restricts the development of organ transplantation, which is also an unresolved challenge in the reform of organ transplantation in China. To alleviate the shortage of donors, western countries have established the working mechanism of systematic multi-department collaboration (SMDC), which has significantly elevated the level of organ donation by promoting systematic collaboration among relevant departments in all aspects of organ donation. At present, organ donation and transplantation in China have entered the new stage of high-quality development, whereas the level of organ donation remains to be further improved. In this article, the concept of SMDC, the procedures and departments related to SMDC, and the international experience of SMDC were illustrated. Besides, suggestions and proposals were delivered for implementing SMDC in China and constantly developing and modifying the Chinese model of organ donation catering to national conditions.

Objective To explore the risk factors of osteoporosis and the relation with pulmonary dysfunction in elderly patients with chronic obstructive lung disease (COPD). Methods One hundred and eighty patients (82 females and 98 males) with acute exacerbation of chronic obstructive lung disease (AECOPD) from March 2006 to June 2008 were selected in the study. The bone mineral density (BMD) of lumbar vertebrae and hip joint were determined by dual energy X-ray absorptiometry(DEXA). All the patients were divided into two COPD groups with and without osteoporsis. The smoking history, incidence of vertebral fractures, glucocorticosteroid using condition and so on were recorded. The pulmonary function, 6-minute walk distance(6MWD), body mass index (BMI) and serum albumin concentration were evaluated. Results The mean age of all patients was (72±7)years, and the average smoking amount was (59±27)pack years. The ratio of forced expiratory volume in 1 second to forced vital capacity (FEV1/FVC) was(36.46±9.8)%, and 30% of the patients had inhaled or oral glucocorticoids for more than 3 months. The BMD measurement results showed that BMD of 95% patients(171 cases) was lower than the normal level, and 119 cases (66%) had osteoporosis, including 61 males and 58 females (62%vs. 70%, x2 = 1.435, P=0.33), and 52 cases had (29%) osteopenia. Linear correlation analysis showed that BMI, 6MWD, RV% and FVC% had positive correlation with osteoporosis (r=0.362, 0.635, 0.688, 0.973;all P<0.05).Conclusions The prevalence of osteoporosis is high in elderly patients with moderate or severe COPD, and enough attention and active intervention shoule be paid.

Objective:To evaluate the safety and feasibility of endovascular recanalization for non-acute internal carotid artery occlusion (NA-ICAO), and to propose a new angiographic classification.Methods:From April 2015 to October 2019, 95 consecutive patients with symptomatic NA-ICAO who received endovascular recanalization were retrospectively analyzed in Beijing Tiantan Hospital, Capital Medical University. All the patients were divided into four groups according to DSA: type Ⅰ, petrous segments were distally reconstituted by collateral vessels; type Ⅱ, cavernous segments were distally reconstituted by collateral vessels; type Ⅲ, ophthalmic segments were distally reconstituted by collateral vessels; type Ⅳ, communicating segments were distally reconstituted by collateral vessels. Study data including clinical characteristics, surgical details, lesion classification, recanalization rate and perioperative complications. For the counting data, the χ 2 test was used to compare between groups. For the quantitative data, the ANOVA was used for the normal distribution data, otherwise the Kruskal-Wallis H test was used. The primary safety outcome was any stroke or death within 30 days. Results:Among the 95 patients, 67 (70.53%) had successful recanalization. The recanalization rates of type Ⅰ－Ⅳ were 92.31% (36/39), 81.82% (18/22), 47.83% (11/23) and 18.18% (2/11) respectively (χ2=29.557, P<0.001). And the complication rates of the four types were 5.13% (2/39), 13.64% (3/22), 21.74% (5/23) and 9.10% (1/11) respectively. The incidence of perioperative ischemic stroke was 2.11% (2/95). No other serious stroke and death occurred. Conclusions:Endovascular recanalization may be feasible and safe for carefully selected patients with NA-ICAO and therefore represents an alternative treatment. The patients with type Ⅰ and Ⅱ lesions had higher recanalization rates, while the patients with type Ⅳ lesions had significantly lower recalculation rate. The new angiographic classification is conducive to the selection of suitable patients and difficulty in grading.

Objective To evaluate the influence of Fuzhenghuayu decoction on fibrotic liver tissue and angiotensin-converting enzyme-angiotensin Ⅱ-angiotensin Ⅱ 1 receptor (ACE-Ang Ⅱ-AT1R) axis using a nonalcoholic fatty liver fibrosis rat model system.Methods Forty male Sprague-Dawley (SD) rats were randomly divided into the following groups:normal control group,liver fibrosis model group,and liver fibrosis model Fuzhenghuayu drug intervention at low-dose [0.75g/(kg.d)] group and high-dose [1.5g/(kg.d)] group.Except the normal control group,the other three groups were fed high-fat diet for 24 weeks to induce nonalcoholic hepatic fibrosis model.The drug intervention was administered via oral-gastric irrigation once daily for 6 times per week over a 6-week period.The rats were sacrificed at the end of 6 weeks for serum and liver tissue collection.The levels of serum total cholesterol (TC),triglycerides (TG),alanine aminotransferase (ALT),aspartate aminotransferase (AST) were measured by standard biochemical assays.The Ang Ⅱ contents of plasma and liver tissue were surveyed and evaluated by the radioimmunoassay method.Liver pathology was detected using HE staining and Masson trichrome staining.The mRNA and protein expressions of ACE,AT1R,α-smooth muscle actin (α-SMA) in the liver tissue were evaluated with real time-PCR,immunohistochemical staining,respectively.Results Compared with the model group,the levels of serum ALT and AST in the low-dose group and high-dose group decreased conspicuously,especially in the high-dose group,with a statistically significant difference (P＜0.05);While the difference in the levels of serum TC and TG between the three groups was not statistically significant.Compared with the normal control group,Ang Ⅱ levels in plasma and liver tissue significantly increased in the other three groups;Further more,there was no significant difference in the plasma Ang Ⅱ level between the three groups (P＞0.05);While the level of liver tissue Ang Ⅱ decreased significantly in the low-dose group and high-dose group than that in model group (P＜0.05).Compared with the model group,the extent of pathological changes in hepatic tissues ameliorated after Fuzhenghuayu intervention according to HE and Masson staining,especially in the high-dose group.According to real time-PCR and immunohistochemical staining,the mRNA and protein expressions of ACE,α-SMA and AT1R decreased significantly in low-dose group and high-dose group than that in model group (P＜0.05),and the high-dose group showed the most robust decrease.Conclusions The Fuzhenghuayu decoction reduces nonalcoholic fatty hepatic fibrosis effectively,thereby leading to down-regulated the expressions of ACE-Ang Ⅱ-AT1R axis.These effects may represent the mechanism by which this drug suppresses hepatic fibrosis.

This study was purposed to detect the serum concentrations of interleukin-17 (IL-17) in patients with multiple myeloma (MM), and to investigate its clinical significance. the serum IL-17 levels in 33 patients with MM and 20 normal control subjects were quantified by using double antibody sandwich ELISA, and serum β2-microglobulin (β2-MG) levels were detected by radioimmunoassay. The results showed that the serum concentrations of IL-17 and β2-MG in patients with MM were significantly higher than those in the control group (P < 0.001), the serum concentrations of IL-17 and β2-MG in active stage were significantly higher than those in stable stage (P < 0.05), the serum concentrations of IL-17 and β2-MG were significantly higher in stage III than that in stage II according to International Staging System (ISS) (P < 0.05), the serum IL-17 and β2-MG levels were significantly correlated (r = 0.690, P < 0.05). It is concluded that the serum IL-17 level correlates with active/stable stages of MM and staging of MM, IL-17 may play an important role in development stage and prognosis of this disease.
Adult ; Aged ; Aged, 80 and over ; Case-Control Studies ; Female ; Humans ; Interleukin-17 ; blood ; Male ; Middle Aged ; Multiple Myeloma ; blood ; pathology ; Neoplasm Staging ; Prognosis

OBJECTIVETo preliminarily study the changes in CD4CD25regulatory T cells (Tregs) in children with severe purulent meningitis at the early stage and its possible implications.

METHODSA retrospective analysis was performed on the clinical data of 39 children with severe purulent meningitis who were admitted to the pediatric intensive care unit from August 2014 to December 2015. According to whether Tregs count was decreased within 12 hours of hospitalization (considering Tregs count <410/mmas decreased), they were divided into two groups: decrease group and non-decrease group. The associations between the changes in Tregs cells and the clinical manifestations, laboratory marker levels, and prognosis were analyzed.

RESULTSOf the 39 cases, 13 (33%) showed a decrease in the proportion of Tregs cells (<31%) and 18 (46%) showed a decrease in the absolute Tregs cell count (<410/mm). Four deaths were all in the Tregs decrease group. Compared with the non-decrease group, the decrease group showed a significantly higher proportion of children with a peripheral blood leukocyte count lower than the normal range and a significantly greater increase in the level of serum procalcitonin (P<0.05).

CONCLUSIONSTregs might be suppressed in children with severe purulent meningitis at the early stage. And its suppression could be related to the severer inflammation reaction and higher mortality in those patients.

C-Reactive Protein ; analysis ; Calcitonin ; blood ; Child ; Child, Preschool ; Female ; Humans ; Infant ; Leukocyte Count ; Male ; Meningitis ; immunology ; Suppuration ; immunology ; T-Lymphocytes, Regulatory ; immunology