1.Prokaryotic expression, purification and identification of recombinant human atrial natriuretic peptide.
Chenhui CHEN ; Ziye ZHAO ; Jin XU ; Xuesong CAO ; Shangjing GUO ; Jun LI ; Hao WANG ; Sheng HOU
Chinese Journal of Biotechnology 2016;32(9):1273-1285
In order to improve the expression of recombinant human atrial natriuretic peptide (ANP), a new plasmid (pET28a(+)/ANP₃) containing 3 tandem ANP genes with lysine codon as the interval linker, was constructed. Target gene was transformed into Escherichia coli BL21 (DE3) and induced by IPTG, about 60% of the total-cell-protein was the target protein, His₆-ANP₃. After denaturation and refolding, it was digested by Endoproteinase Lys-C and Carboxypeptidase B (CPB) and then purified by a series of purification processes, about 16 mg purified ANP monomer could be obtained from one liter bacteria broth of shaking culture. Ultimately, the purity of protein was above 90% determined by UPLC and Tricine SDS-PAGE, its molecular weight was 3 080 Da according to LC-MS identification and it was proved to be equivalent to the reference product by ELISA. The use of tandem gene expression can provide a new possible model for the expression of other peptide drugs.
Atrial Natriuretic Factor
;
biosynthesis
;
Electrophoresis, Polyacrylamide Gel
;
Escherichia coli
;
metabolism
;
Gene Expression
;
Humans
;
Metalloendopeptidases
;
Peptides
;
Plasmids
;
genetics
;
Recombinant Fusion Proteins
;
biosynthesis
2.Construct a molecular switch based on bacterial quorum sensing.
Chinese Journal of Biotechnology 2013;29(9):1301-1312
Engineering the existing or manual assembling biosynthetic pathways involves two important issues: the activity and expression level of key enzymes in the pathway. Concerning the enzyme expression study, the conventional approach is to use strong promoter to initiate the overexpression of the target protein. The excessive expression of the target protein usually result in the intracellular accumulation of a large number of inactive inclusion bodies, thereby seriously affect the physiological state of the cell and the effective functioning of the relevant biological pathways. To solve this problem, we would like to design a molecular switch to precisely manipulate the expression level of key enzymes in the biosynthetic process, which has important practical value for the study of metabolic rhythm of the biosynthetic pathway and to promote the efficiency of the biosynthetic pathway. Based on the basic principles of quorum sensing existing in the bacterial community and combining the dynamic characteristics of the enzymatic catalysis, we first established cell-cell communication mechanisms mediated by signal molecule homoserine lactone (AHL) in the E. coli community and target protein EGFP was expressed under the control of the promoter P(lux1). In the process of cell growth, AHL accumulated to a certain concentration to start the expression of target gene egfp. At the different cell growth stages, AHL-degrading enzyme AiiA was induced and resulted in the degradation of AHL molecule in a controlled environment, thereby controlling the transcription efficiency of target gene egfp and ultimately achieve the precise control of the level of expression of the target protein EGFP. The detection of cell growth state, the mRNA level and protein expression level of the target gene showed the artificially designed molecular switch can control the level of expression of a target gene in a convenient and efficient manner with a spatial and temporal regulation of rigor. The molecular switch is expected to be widely used in the field of metabolic engineering and synthetic biology research areas.
Carboxylic Ester Hydrolases
;
genetics
;
Escherichia coli
;
enzymology
;
genetics
;
physiology
;
Gene Expression Regulation, Bacterial
;
Green Fluorescent Proteins
;
biosynthesis
;
genetics
;
Metalloendopeptidases
;
genetics
;
Quorum Sensing
;
genetics
;
physiology
3.Two characteristics of a recombinant fusion protein composed of staphylokinase and hirudin: high thrombus affinity and thrombus-targeting release ofanticoagulant activity.
Aiping YU ; Chuanling ZHANG ; Chunna DONG ; Hongyang YU ; Genshen ZHONG ; Lisheng WANG ; Chutse WU
Chinese Journal of Biotechnology 2008;24(11):1955-1961
To improve thrombolytic effect, a fusion protein SFH composed of staphylokinase (SAK) and hirudin (HV) with blood coagulation factor Xa (FXa) recognition peptide as a linker, was designed. SFH showed improved thrombolytic effect and low bleeding in vivo. Two thrombus-targeting mechanisms might account for the above features of SFH. This study was designed to study the two thrombus-targeting mechanisms of SFH. ELISA and immunohistochemistry assay were used to study the improved thrombus selectivity of SFH and the results showed that SFH, compared with SAK, displayed higher affinity for thrombin and thrombin-rich thrombus. To verify the thrombus-targeting release of anticoagulant activity of SFH, FH-a derivative of HV with only FXa recognition sequence at N terminus of HV was designed and used in animal tests. In inferior vena cava thrombosis model, FH showed equal antithrombotic effect as HV, indicating that HV could be successfully released from FH by FXa cleavage in vivo. More importantly, no prolongation of plasma TT, APTT and PT were found in FH group, but significant prolongations were discovered in HV group. This revealed that the anticoagulant activity of FH was released in thrombus-targeting way and limited in the vicinity of the thrombus, and this could be extrapolated to SFH. In conclusion, the high thrombus affinity and thrombus-targeting release of anticoagulant activity of SFH assigned low bleeding risk to SFH.
Animals
;
Anticoagulants
;
pharmacology
;
Factor X
;
pharmacology
;
Hirudins
;
biosynthesis
;
genetics
;
Metalloendopeptidases
;
biosynthesis
;
genetics
;
Mice
;
Rats
;
Recombinant Fusion Proteins
;
biosynthesis
;
genetics
;
pharmacology
;
Thrombolytic Therapy
;
methods
;
Thrombosis
;
drug therapy
;
Vena Cava, Inferior
4.Association of CD133 and endothelin-converting enzyme expressions with prognosis of non-small cell lung carcinoma.
Hui-zhong ZHANG ; Yi-ping WEI ; Mei WANG ; Cheng WU ; Yan-qi YANG ; Ju CHEN ; Yong-ke CAO
Journal of Southern Medical University 2007;27(5):696-699
OBJECTIVETo investigate the expression of tumor stem cell marker CD133 and endothelin-converting enzymes (ECE) in non-small cell lung carcinoma (NSCLC) and their association with NSCLC lymphoid metastasis.
METHODSCD133 and ECE expressions was detected immunohistochemically in the specimens from 77 patients with NSCLC, and the association of CD133 and ECE expressions with the tumor size, histological type, differentiation, lymphoid metastasis, and prognosis of NSCLC was analyzed.
RESULTSThe positive expression rate of CD133 and ECE was 51.9% (40/77) and 45.5% (35/77) in these specimens, respectively. Both CD133 and ECE expressions were associated positively with lymphoid metastasis (r=0.246 and 0.339, P<0.05), and inversely with the survival time of the patients (P<0.05). CD133 and ECE expressions were not related to tumor size, histological type, and differentiation of the tumor (P>0.05). CD133 expression was associated positively with ECE expression in NSCLC (r=0.249, P<0.05).
CONCLUSIONCD133 and ECE expressions are associated with lymphoid metastasis and prognosis of NSCLC, and their overexpression often suggests unfavorable prognosis of NSCLC.
AC133 Antigen ; Adult ; Aged ; Antigens, CD ; biosynthesis ; Aspartic Acid Endopeptidases ; biosynthesis ; Carcinoma, Non-Small-Cell Lung ; metabolism ; pathology ; Endothelin-Converting Enzymes ; Female ; Glycoproteins ; biosynthesis ; Humans ; Immunohistochemistry ; Lung Neoplasms ; metabolism ; pathology ; Lymphatic Metastasis ; Male ; Metalloendopeptidases ; biosynthesis ; Middle Aged ; Peptides ; Prognosis
5.Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus.
Yan-Yu ZHANG ; Ping MA ; Yi-Ming LU ; Li-Ping LÜ ; Sheng-Yang JIANG ; Xi-Peng ZHOU ; Shu-Han SUN ; Jin-Bo XU
Journal of Experimental Hematology 2005;13(4):542-547
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.
Agkistrodon
;
genetics
;
Amino Acid Sequence
;
Animals
;
Base Sequence
;
Cloning, Molecular
;
Crotalid Venoms
;
biosynthesis
;
enzymology
;
genetics
;
DNA, Complementary
;
chemistry
;
genetics
;
Escherichia coli
;
genetics
;
Metalloendopeptidases
;
biosynthesis
;
genetics
;
Molecular Sequence Data
;
Recombinant Proteins
;
biosynthesis
;
Reverse Transcriptase Polymerase Chain Reaction
;
Sequence Analysis, DNA
;
Sequence Homology, Nucleic Acid
;
Thrombin
;
biosynthesis
;
genetics
6.Preparation and activity analysis of RGD-mSAK (K130T, K135R).
Bao-An NING ; Ru MA ; Yu-Ling ZHENG ; Zhi-Xian GAO ; Bo SHEN ; Yong-Qiang JIANG
Chinese Journal of Biotechnology 2005;21(3):456-460
In order to construct RGD-mSAK mutant with reduced immunogenicity, and identify its biological activity after purification, mSAK gene fragment was amplified by over-lapping extension PCR. Then the gene was inserted into the prokaryotic expression vector pBV220 with P(R)P(L) promoters after confirmed by DNA sequencing; the expression plasmid pBV220-RGD-mSAK was constructed, and then was transformed into E. coli. DH5alpha. After temperature induction, the mutant Staphylokinase was over-expressed and much of protein was in the supernate of lysate, which is over 50% of total protein in the host. The protein was isolated and purified in Q-Sepharose FF, Sephacryl S-200 and SP, high purity protein was obtained and its purity was over 98%. The thrombolysis activity of the RGD-mSAK protein is 1.68 x 10(5) u/mg by fibrin plate assay, which is slightly higher than that of the wild-type, and antiserum titers raised against this protein in guinea pigs were much lower than those of wild-type SAK, determined by ELISA. In anti-platelets aggregation assay in vitro, the RGD-mSAK protein has obvious inhibition activity of platelet aggregation in low concentration comparing to the control group and wild-type SAK group. So the RGD-mSAK protein is a low immunogenicity, bi-function molecular with both thrombolysis activity and anti-embolism activity. It provided the basis for further research of RGD-SAK.
Animals
;
Base Sequence
;
Escherichia coli
;
genetics
;
metabolism
;
Guinea Pigs
;
Metalloendopeptidases
;
biosynthesis
;
metabolism
;
Molecular Sequence Data
;
Mutant Proteins
;
biosynthesis
;
genetics
;
Oligopeptides
;
metabolism
;
Platelet Aggregation
;
drug effects
;
Platelet Aggregation Inhibitors
;
pharmacology
;
Protein Engineering
;
Recombinant Proteins
;
biosynthesis
;
genetics
;
isolation & purification
7.Expression of a disintegrin-like and metalloproteinase protein 8 and 12 in the giant cell lesions of jaw.
Chinese Journal of Stomatology 2004;39(4):294-297
OBJECTIVETo detect the expression of a disintegrin-like and metalloproteinase (ADAM) 8 and 12 gene in the giant cell lesions of jaw and to study their effects on the histogenesis of cells in these lesions.
METHODSADAM8 and ADAM12 was detected by immunohistochemistry (SP) in 40 paraffin-embedded specimens of central giant cell lesions of jaw, 10 peripheral giant cell lesions, 9 cherubisms, 6 aneurysmal bone cysts.
RESULTSADAM8 and ADAM12 were positive in the cytomembrane and cytoplasm of all multinucleated giant cells and some round mononuclear cells of the lesions; ADAM12 was positive for some spindle mononuclear stromal cells in central and peripheral giant cell lesions.
CONCLUSIONSMultinucleated giant cells probably originated from the fusion of the round mononuclear cells, and ADAM8 and ADAM12 were involved in this process. In addition, ADAM12 might play a role in the maturation of spindle mononuclear stromal cells.
ADAM Proteins ; ADAM12 Protein ; Antigens, CD ; biosynthesis ; genetics ; metabolism ; Giant Cell Tumor of Bone ; enzymology ; genetics ; Humans ; Jaw Neoplasms ; enzymology ; genetics ; Maxillary Neoplasms ; enzymology ; genetics ; Membrane Proteins ; biosynthesis ; genetics ; metabolism ; Metalloendopeptidases ; biosynthesis ; genetics ; metabolism
8.Expression of mRNA for membrane-type 1, 2, and 3 matrix metalloproteinases in human laryngeal cancer.
Chinese Medical Sciences Journal 2004;19(3):170-173
OBJECTIVETo investigate correlation of expressions of membrane-type 1, 2, and 3 matrix metalloproteinases (MT1, MT2, and MT3-MMP) to the invasion and metastases in laryngeal cancer.
METHODSReverse transcription-polymerase chain reaction (RT-PCR) was used to examine the mRNA level of MT1, MT2, and MT3-MMP in 24 patients with laryngeal cancer. The relationships of these three MT-MMP expressions to clinicopathology were analyzed by statistics.
RESULTSThe expressions of MT1, MT2, and MT3-MMP were significantly higher in laryngeal cancer tissues than those in para-tumorous tissues (P < 0.01) and had a close relationship with invasive depth (P < 0.05). But no significantly different expressions of these three MT-MMPs were found in different primary location and different histological grade of laryngeal cancer (P > 0.05). The expression of MT1-MMP was obviously higher in patients with metastatic lymph nodes than that in patients without metastatic lymph nodes (P < 0.05).
CONCLUSIONMT1, MT2, and MT3-MMP play an important role in the progression of laryngeal cancer, and MT1-MMP may serve as a reliable marker in estimating invasive and metastatic potency of laryngeal cancer. Suppressing expressions of MT1, MT2, and MT3-MMP early may inhibit the invasion and metastases of laryngeal cancer.
Adult ; Aged ; Biomarkers, Tumor ; analysis ; Female ; Gene Expression Regulation, Neoplastic ; Humans ; Laryngeal Neoplasms ; metabolism ; pathology ; Larynx ; metabolism ; Lymphatic Metastasis ; Male ; Matrix Metalloproteinase 16 ; Matrix Metalloproteinases, Membrane-Associated ; Metalloendopeptidases ; biosynthesis ; genetics ; Middle Aged ; Neoplasm Invasiveness ; RNA, Messenger ; biosynthesis
9.Effects of baicalin on the expression of pro-MMP-1 and MMP-3 in human gingival fibroblasts and periodontal ligament cells.
Cheng-zhang LI ; Zheng-guo CAO ; Ru YANG ; Zhu-huan SHANG ; Li-jian JIN ; E F COBERT
Chinese Journal of Stomatology 2004;39(3):197-200
OBJECTIVETo investigate the influence of baicalin on the IL-1beta induced pro-MMP-1 in HGF and the effects of baicalin on MMP-3 expression in periodontal ligament cells (PDLCs).
METHODSThe amount of secreted pro-MMP-1 and MMP-3 expression was detected by ELISA and cell immunochemistry.
RESULTS(1) The amount of secreted pro-MMP-1 (3.333 +/- 0.123) microg/L increased significantly following 1 microg/L of IL-1beta, compared with control group (1.960 +/- 0.180) microg/L. Addition of baicalin to cell culture medium for 1 hour following IL-1beta decreased pro-MMP-1 secretion in a dose-dependent manner in the range of 10 approximately 1,000 microg/L. (2) 1 microg/L IL-1beta could significantly stimulate the synthesis and secretion of MMP-3 in PDLCs. (3) The baicalin could not interfere the synthesis of MMP-3, but could inhibit the release of MMP-3 from PDLCs.
CONCLUSIONSBaicalin could inhibit the secretion of pro-MMP-1 and MMP-3 expression in IL-1beta induced HGF and PDLCs, which suggests that baicalin may play an important role in preventing and treating periodontal disease.
Collagenases ; biosynthesis ; genetics ; Enzyme Precursors ; biosynthesis ; genetics ; Fibroblasts ; enzymology ; pathology ; Flavonoids ; pharmacology ; Gingiva ; enzymology ; pathology ; Humans ; Interleukin-1 ; pharmacology ; Interleukin-1beta ; Matrix Metalloproteinase 1 ; Metalloendopeptidases ; biosynthesis ; genetics ; Peptide Fragments ; pharmacology ; Periodontal Ligament ; enzymology ; pathology ; Periodontitis ; enzymology ; pathology ; Scutellaria ; chemistry
10.Study of the effects of LPS on the TACE gene expression and its function.
Lingbo LI ; Yuzhen YANG ; Zhen WANG ; FeiLi GONG
Journal of Huazhong University of Science and Technology (Medical Sciences) 2002;22(1):5-8
In order to investigate the effects of LPS on the TACE gene transcription and expression and its regulating effect on the TM-TNF secretion, in vitro studies were carried out on HL-60 cells stimulated by LPS. TACE, TNF-alpha mRNA levels were detected by Dot-Elisa and the distribution of membrane molecules determined by flow cytometry assay and indirect immunofluorescence. The results showed that: (1) TACE was detected in or on HL-60 cells and it is predominantly localized on cell surface and to a perinuclear compartment. (2) LPS induced a time dependent increasement of TNF-alpha mRNA and enhanced TNF conversion with decreasing distribution of TNF in cell surface and increasing secretion of TNF protein. Such conversion could be inhibited by TACE ODN. (3) LPS also induced time-dependently increased expression of TACE gene and activation of its function. On the other hand, TACE protein in cell lysate and on cell surface was decreased. It was suggested that TACE molecular structure might change following its mediating membrane-anchored molecular secretion.
ADAM Proteins
;
ADAM17 Protein
;
Gene Expression
;
HL-60 Cells
;
Humans
;
Lipopolysaccharides
;
pharmacology
;
Metalloendopeptidases
;
biosynthesis
;
genetics
;
RNA, Messenger
;
biosynthesis
;
genetics
;
Transcription, Genetic
;
Tumor Necrosis Factor-alpha
;
biosynthesis
;
genetics

Result Analysis
Print
Save
E-mail