PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels

BACKGROUND: Chronic placental inflammation, such as villitis of unknown etiology (VUE) and chronic chorioamnionitis (CCA), is considered a placental manifestation of maternal anti-fetal rejection. The aim of this study is to investigate its frequency in twin pregnancies compared to singleton pregnancies. METHODS: Three hundred twin placentas and 1,270 singleton placentas were consecutively collected at a tertiary medical center in Seoul, Republic of Korea from 2009 to 2012. Hematoxylin and eosin sections of tissue samples (full-thickness placental disc and chorioamniotic membranes) were reviewed. RESULTS: Non-basal VUE was more frequent in twin placentas than in singleton placentas (6.0% vs 3.2%, p < .05). In preterm birth, CCA was found less frequently in twin placentas than in singleton placentas (9.6% vs 14.8%, p < .05), reaching its peak at an earlier gestational age in twin placentas (29-32 weeks) than in singleton placentas (33-36 weeks). CCA was more frequent in twin pregnancies with babies of a different sex than with those with the same sex (13.8% vs 6.9%, p=.052). Separate dichorionic diamniotic twin placentas were affected by chronic deciduitis more frequently than singleton placentas (16.9% vs 9.7%, p<.05). CONCLUSIONS: The higher frequency of non-basal VUE in twin placentas and of CCA in twin placentas with different fetal sex supports the hypothesis that the underlying pathophysiological mechanism is maternal anti-fetal rejection related to increased fetal antigens in twin pregnancies. The peak of CCA at an earlier gestational age in twin placentas than in singleton placentas suggests that CCA is influenced by placental maturation.
Chorioamnionitis ; Eosine Yellowish-(YS) ; Female ; Gestational Age ; Hematoxylin ; Humans ; Inflammation* ; Placenta ; Pregnancy ; Pregnancy, Twin* ; Premature Birth ; Republic of Korea ; Seoul ; Twins*

BACKGROUND/AIMS: Recent data from Western populations have suggested that patients with sporadic duodenal adenomas are at a higher risk for the development of colorectal neoplasia. In this study, we compared the frequency of colorectal neoplasia in patients with sporadic duodenal adenomas to healthy control subjects. METHODS: This retrospective case-control study used the databases of 3 teaching hospitals in Gyeonggi-do Province, South Korea. The colonoscopy findings of patients with sporadic duodenal adenomas were compared with those of age- and gender-matched healthy individuals who had undergone gastroduodenoscopies and colonoscopies during general screening examinations. RESULTS: Between 2001 and 2008, 45 patients were diagnosed endoscopically with sporadic duodenal adenomas; 26 (58%) of these patients received colonoscopies. Colorectal neoplasia (42% vs 21%; odds ratio [OR], 2.8; 95% confidence interval [CI], 1.1 to 7.4) and advanced colorectal adenoma (19% vs 3%; OR, 9.0; 95% CI, 1.6 to 50.0) were significantly more common in patients with sporadic duodenal adenomas than in healthy control subjects. CONCLUSIONS: Compared with healthy individuals, patients with sporadic duodenal adenomas were at a significantly higher risk for developing colorectal neoplasia. Such at-risk patients should undergo routine screening colonoscopies.
Adenoma ; Case-Control Studies ; Colonoscopy ; Colorectal Neoplasms ; Duodenal Neoplasms ; Endoscopy ; Hospitals, Teaching ; Humans ; Mass Screening ; Odds Ratio ; Prevalence ; Republic of Korea ; Retrospective Studies

PURPOSE: In order to evaluate the clinical relevance of angiogenesis in patients with gastric cancer, we investigated the microvessel count in gastric cancer tissues and compared the results with several clinicopathologic factors and prognosis. MATERIALS AND METHODS: A total of 256 patients with gastric cancer who underwent curative surgery were included in this study. Microvessel count was determined by im-munohistochemical staining using monoclonal antibody against factor VIII-related antigen. RESULTS: The statistical significance between the microvessel count and clinicopathologic factors (age, sex, tumor invasion, lymph node involvement, histologic type) was analized. The tumor stage and histologic type were correlated with microvessel count. And also there was statistical significance with survival rate and recurrence-free survival rate between high (microvessel count> or =42) and low angiogeneic group (microvessel count< 42). The Cox's proportional hazard model showed that stage, histologic type, angiogeneic score were one of the significant and independent prognostic variables. CONCLUSION: The tumor angiogenesis of gastric carcinoma may be independent prognostic factor for predicting recurrence and survival.
Humans ; Lymph Nodes ; Microvessels ; Prognosis* ; Proportional Hazards Models ; Recurrence ; Stomach Neoplasms ; Survival Rate ; von Willebrand Factor

BACKGROUND: Gastrointestinal stromal tumors (GIST) are the most common mesenchymal tumors of the gastrointestinal tract. The GISTs are immunohistochemically defined as KIT (CD117) positive tumors. To evaluate the prognostic factors for GISTs, we investigated the clinicopathological factors and the patient's survival rate. METHODS: Between 1996 and 2002, 37 patients were diagnosed with GIST at Dong-A University Medical Center, and 34 of these patients with localized GIST underwent surgical resection. For the immunohistochemical staining, we used KIT, CD34, s100 and SMA. RESULTS: The primary tumor site was the stomach (60%), and this was followed by small intestine (40%). The most common tumor morphology was spindle cell (83%) followed by epithelial cell (17%). An immunohistochemical analysis revealed that KIT was expressed 100% and CD34 was expressed in 29 cases (78.4%), SMA in 13 patients (35%), and s100 in 7 patients (18.9%). According to the tumor size and mitotic count, 4 patients were classified as very low, 8 were low, 14 were intermediate and 8 patients were high risk. Nine patients (24.3%) underwent adjuvant chemotherapy. The median follow up duration was 29 months. The 5-year disease free survivalrate was 55.1%, and 5-year overall survival rate was 72.8%. The 5-year disease free survival rates for patients with very low and low risk classifications were 100%, and the intermediate risk and high risk were 76.4% and 38.9%, respectively (p=0.1489). The five year overall survival rates for patients with very low and low risk classification were 100%, and intermediate risk and high risk were 90.0% and 0%, respectively (p=0.0179). However, age, pathologic subtype, adjuvant chemotherapy, and immunohistochemical stain results were not significant prognostic factors. CONCLUSION: These results suggest that risk stratification was the most important prognostic factor in GISTs.
Academic Medical Centers ; Chemotherapy, Adjuvant ; Classification ; Disease-Free Survival ; Epithelial Cells ; Follow-Up Studies ; Gastrointestinal Stromal Tumors* ; Gastrointestinal Tract ; Humans ; Intestine, Small ; Stomach ; Survival Rate

Objective: This study aimed 1) to investigate the clinical characteristics of amniotic fluid embolism (AFE) cases clinically diagnosed by maternal fetal medicine (MFM) specialists in Korea, 2) to check the disagreement with 4 recently proposed criteria by the Society for Maternal-Fetal Medicine (SMFM) for research purpose, and 3) to compare maternal outcomes between cases satisfying all 4 criteria and cases with at least 1 missing criterion. Methods: This study included 12 patients clinically diagnosed with AFE from 7 referral hospitals in Korea. We collected information, including maternal age, symptoms of AFE, the amount of transfusion, and maternal mortality. Results: The median maternal age was 33 years (range, 28–40 years). Regarding symptoms, cardiovascular arrest, hypotension, respiratory compromise, clinical coagulopathy, and neurologic signs were observed in 41.7%, 83.3%, 83.3%, 100%, and 66.7% of the cases, respectively. Among the 12 cases, 5 women died and 2 suffered severe neurologic disability, showing an intact survival rate of 41.7%. Disagreement with all 4 criteria proposed by the SMFM was found in 66.7% of the cases, due to the lack of criteria for disseminated intravascular coagulation or strict onset time (<30 minutes after delivery). There was no difference in maternal mortality and the amount of transfusion between cases satisfying all 4 criteria and cases with at least 1 missing criterion. Conclusion Two-thirds of clinically confirmed AFE cases did not satisfy all 4 criteria proposed by the SMFM, despite similar rates of maternal mortality with cases satisfying all 4 criteria. Our study suggests that there may be some discrepancy between the clinical diagnosis of AFE and the recent diagnostic criteria proposed by the SMFM for research purpose.

Objective: This study aimed 1) to investigate the clinical characteristics of amniotic fluid embolism (AFE) cases clinically diagnosed by maternal fetal medicine (MFM) specialists in Korea, 2) to check the disagreement with 4 recently proposed criteria by the Society for Maternal-Fetal Medicine (SMFM) for research purpose, and 3) to compare maternal outcomes between cases satisfying all 4 criteria and cases with at least 1 missing criterion. Methods: This study included 12 patients clinically diagnosed with AFE from 7 referral hospitals in Korea. We collected information, including maternal age, symptoms of AFE, the amount of transfusion, and maternal mortality. Results: The median maternal age was 33 years (range, 28–40 years). Regarding symptoms, cardiovascular arrest, hypotension, respiratory compromise, clinical coagulopathy, and neurologic signs were observed in 41.7%, 83.3%, 83.3%, 100%, and 66.7% of the cases, respectively. Among the 12 cases, 5 women died and 2 suffered severe neurologic disability, showing an intact survival rate of 41.7%. Disagreement with all 4 criteria proposed by the SMFM was found in 66.7% of the cases, due to the lack of criteria for disseminated intravascular coagulation or strict onset time (<30 minutes after delivery). There was no difference in maternal mortality and the amount of transfusion between cases satisfying all 4 criteria and cases with at least 1 missing criterion. Conclusion Two-thirds of clinically confirmed AFE cases did not satisfy all 4 criteria proposed by the SMFM, despite similar rates of maternal mortality with cases satisfying all 4 criteria. Our study suggests that there may be some discrepancy between the clinical diagnosis of AFE and the recent diagnostic criteria proposed by the SMFM for research purpose.

Background: People are generally considered overweight and obese if their body mass index (BMI) is above 25 kg/m 2 and 30.0 kg/m 2 , respectively. The World Health Organization proposed stricter criteria for Asians (≥ 23 kg/m2 : overweight, ≥ 25 kg/m2 : obese). We aimed to verify whether this criteria could predict adverse pregnancy outcomes in Korean women. Methods: We included 7,547 Korean women from 12 institutions enrolled between June 2016 and October 2018. Women with no pre-pregnancy BMI data, not Korean, or lost to followup were excluded, leaving 6,331. The subjects were categorized into underweight, normal, overweight, class I obesity, and class II/III obesity based on a pre-pregnancy BMI of < 18.5, 18.5–22.9, 23.0–24.9, 25.0–29.9, and ≥ 30.0 kg/m2 , respectively. Results: Overall, 13.4%, 63.0%, 11.8%, 9.1%, and 2.6% of women were underweight, normal, and overweight and had class I obesity and class II/III obesity, respectively. In the multivariable analysis adjusted for maternal age, a higher BMI significantly increased the risk of preeclampsia, gestational diabetes, preterm delivery caused by maternal-fetal indications, cesarean section, large for gestational age, and neonatal intensive care unit admission. Conclusion Adverse pregnancy outcomes started to increase in those with a pre-pregnancy BMI ≥ 23.0 kg/m2 after adjusting for maternal age. The modified obesity criteria could help predict adverse pregnancy outcomes in Koreans.