ObjectiveTo understand the measles, rubella, and mumps antibody seroprevalence among the children aged 18 years and younger in Karamay City, and to evaluate the effectiveness of vaccination. MethodsA stratified whole cluster random sampling method was used to investigate the antibody seroprevalence of measles, rubella, and mumps among the healthy children aged 18 years and younger in Karamay City, and to further analyze the positive antibody rates and the geometric mean concentration (GMC) of antibodies. ResultsA total of 620 people were investigated, and the positive rates of IgG to measles, rubella, and mumps were 72.74%,62.26%, and 86.45%, respectively, with a GMC of308.94 mIU·mL^-1, 21.81 mIU·mL^-1, and 249.10 U·mL^-1. There were statistically significant differences in the positive rates of antibodies to measles, rubella, and mumps among different age groups (χ²_measles=76.707, P<0.001; χ²_rubella=60.804, P<0.001; χ²_mumps=35.407, P<0.001). The differences in positive rates were statistically significant among individuals with different intervals from the time of their last dose vaccination (χ²_measles=60.533, P<0.001; χ²_rubella=46.331, P<0.001; χ²_mumps=22.825, P<0.001). ConclusionThe antibody levels of measles, rubella and mumps among the people aged 18 years and younger in Karamay City are found to be low. Two doses of measles-mumps-rubella (MMR) vaccine should be given to children born before 2020, and if necessary, supplementary immunization with MMR vaccine should be carried out before they are enrolled in nursery and kindergarten. Additionally, regular population-based antibody surveillance should be conducted to promptly identify the people with weak immunity, which is conducive to effectively reducing and controlling the epidemic situation of measles, rubella and mumps in schools.

ObjectiveThis study aimed to explore the effects of aerobic exercise on cognitive function in aging mice and to elucidate the underlying molecular mechanisms by which aerobic exercise ameliorates cognitive decline through the regulation of gut microbiota-metabolite network. By providing novel insights into the interplay between exercise, gut microbiota, and cognitive health, this research seeks to offer a robust theoretical foundation for developing anti-aging strategies and personalized exercise interventions targeting aging-related cognitive dysfunction. MethodsUsing naturally aged C57BL/6 mice as the experimental model, this study employed a multi-omics approach combining 16S rRNA sequencing and wide-targeted metabolomics analysis. A total of 18 mice were divided into 3 groups: young control (YC, 4-month-old), old control (OC, 21-month-old), and old+exercise (OE, 21-month-old with 12 weeks of moderate-intensity treadmill training) groups. Behavioral assessments, including the Morris water maze (MWM) test, were conducted to evaluate cognitive function. Histopathological examinations of brain tissue sections provided morphological evidence of neuronal changes. Fecal samples were collected for gut microbiota and metabolite profiling via 16S rRNA sequencing and ultra-performance liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (UPLC-QTOF-MS). Data were analyzed using a combination of statistical and bioinformatics tools to identify differentially abundant microbial taxa and metabolites and to construct interaction networks between them. ResultsBehavioral tests revealed that 12 weeks of aerobic exercise significantly improved spatial learning and memory capacity of aged mice, as evidenced by reduced escape latency and increased target area exploration and platform crossings in the MWM. Histopathological analysis demonstrated that exercise mitigated aging-related neuronal damage in the hippocampus, enhancing neuronal density and morphology. 16S rRNA sequencing indicated that exercise increased gut microbiota α‑diversity and enriched beneficial bacterial genera, including Bifidobacterium, Parabacteroides, and Rikenella. Metabolomics analysis identified 32 differentially regulated metabolites between OC and OE groups, with 94 up-regulated and 30 down-regulated in the OE group when compared with OC group. These metabolites were primarily involved in energy metabolism reprogramming (e.g., L-homocitrulline), antioxidant defense (e.g., L-carnosine), neuroprotection (e.g., lithocholic acid), and DNA repair (e.g., ADP-ribose). Network analysis further revealed strong positive correlations between specific bacteria and metabolites, such as Parabacteroides with ADP-ribose and Bifidobacterium with lithocholic acid, suggesting potential neuroprotective pathways mediated by the gut microbiota-metabolite axis. ConclusionThis study provides comprehensive evidence that aerobic exercise elicits cognitive benefits in aging mice by modulating the gut microbiota-metabolite network. These findings highlight three key mechanisms: (1) the proliferation of beneficial gut bacteria enhances metabolic reprogramming to boost DNA repair pathways; (2) elevated neuroinflammation-inhibiting factors reduce neurodegenerative changes; and (3) enhanced antioxidant defenses maintain neuronal homeostasis. These results underscore the critical role of the “microbiota-metabolite-brain” axis in mediating the cognitive benefits of aerobic exercise. This study not only advances our understanding of the gut-brain axis in aging but also offers a scientific basis for developing personalized exercise and probiotic-based interventions targeting aging-related cognitive decline. Future research should further validate these mechanisms in non-human primates and human clinical trials to establish the translational potential of exercise-induced gut microbiota-metabolite modulation for combating neurodegenerative diseases.

BACKGROUND: Spicy food consumption has been reported to be inversely associated with mortality from multiple diseases. However, the effect of spicy food intake on the incidence of vascular diseases in the Chinese population remains unclear. This study was conducted to explore this association. METHODS: This study was performed using the large-scale China Kadoorie Biobank (CKB) prospective cohort of 486,335 participants. The primary outcomes were vascular disease, ischemic heart disease (IHD), major coronary events (MCEs), cerebrovascular disease, stroke, and non-stroke cerebrovascular disease. A Cox proportional hazards regression model was used to assess the association between spicy food consumption and incident vascular diseases. Subgroup analysis was also performed to evaluate the heterogeneity of the association between spicy food consumption and the risk of vascular disease stratified by several basic characteristics. In addition, the joint effects of spicy food consumption and the healthy lifestyle score on the risk of vascular disease were also evaluated, and sensitivity analyses were performed to assess the reliability of the association results. RESULTS: During a median follow-up time of 12.1 years, a total of 136,125 patients with vascular disease, 46,689 patients with IHD, 10,097 patients with MCEs, 80,114 patients with cerebrovascular disease, 56,726 patients with stroke, and 40,098 patients with non-stroke cerebrovascular disease were identified. Participants who consumed spicy food 1-2 days/week (hazard ratio [HR] = 0.95, 95% confidence interval [95% CI] = [0.93, 0.97], P <0.001), 3-5 days/week (HR = 0.96, 95% CI = [0.94, 0.99], P = 0.003), and 6-7 days/week (HR = 0.97, 95% CI = [0.95, 0.99], P = 0.002) had a significantly lower risk of vascular disease than those who consumed spicy food less than once a week ( Ptrend <0.001), especially in those who were younger and living in rural areas. Notably, the disease-based subgroup analysis indicated that the inverse associations remained in IHD ( Ptrend = 0.011) and MCEs ( Ptrend = 0.002) risk. Intriguingly, there was an interaction effect between spicy food consumption and the healthy lifestyle score on the risk of IHD ( Pinteraction = 0.037). CONCLUSIONS Our findings support an inverse association between spicy food consumption and vascular disease in the Chinese population, which may provide additional dietary guidance for the prevention of vascular diseases.
Humans ; Male ; Female ; Prospective Studies ; Middle Aged ; Aged ; Vascular Diseases/etiology* ; Risk Factors ; China/epidemiology* ; Adult ; Proportional Hazards Models ; Cerebrovascular Disorders/epidemiology* ; East Asian People

Recent advances in large models demonstrate significant prospects for transforming the field of medical imaging. These models, including large language models, large visual models, and multimodal large models, offer unprecedented capabilities in processing and interpreting complex medical data across various imaging modalities. By leveraging self-supervised pretraining on vast unlabeled datasets, cross-modal representation learning, and domain-specific medical knowledge adaptation through fine-tuning, large models can achieve higher diagnostic accuracy and more efficient workflows for key clinical tasks. This review summarizes the concepts, methods, and progress of large models in medical imaging, highlighting their potential in precision medicine. The article first outlines the integration of multimodal data under large model technologies, approaches for training large models with medical datasets, and the need for robust evaluation metrics. It then explores how large models can revolutionize applications in critical tasks such as image segmentation, disease diagnosis, personalized treatment strategies, and real-time interactive systems, thus pushing the boundaries of traditional imaging analysis. Despite their potential, the practical implementation of large models in medical imaging faces notable challenges, including the scarcity of high-quality medical data, the need for optimized perception of imaging phenotypes, safety considerations, and seamless integration with existing clinical workflows and equipment. As research progresses, the development of more efficient, interpretable, and generalizable models will be critical to ensuring their reliable deployment across diverse clinical environments. This review aims to provide insights into the current state of the field and provide directions for future research to facilitate the broader adoption of large models in clinical practice.
Humans ; Diagnostic Imaging/methods* ; Precision Medicine/methods* ; Image Processing, Computer-Assisted/methods*

Eight butyl-phthalides, senkyunolide K(1), senkyunolide N(2), butylphthalide(3), senkyunolide I(4), senkyunolide H(5),(Z)-butylidenephthalide(6),(Z)-ligustilide(7), and 3-butylidene-7-hydroxyphthalide(8) were isolated from the aerial part of Ligusticum sinense by column chromatography on silica gel column, ODS, Sephadex LH-20 and semi-preparative HPLC. Their structures were elucidated on the basis of spectroscopic and chemical data, especially NMR and MS. Compound 1 was a new butyl-phthalide and compounds 2-8 were isolated from the aerial part of L. sinense for the first time. Furthermore, the inhibitory activities of compounds 1-8 against the nitric oxide(NO) production induced by lipopolysaccharide(LPS) in mouse RAW264.7 macrophages in vitro were evaluated. The results showed that compounds 1-8 exerted inhibitory activities on NO production with IC_(50) of 19.34-42.16 μmol·L~(-1).
Animals ; Mice ; Nitric Oxide/biosynthesis* ; Ligusticum/chemistry* ; Benzofurans/isolation & purification* ; Drugs, Chinese Herbal/isolation & purification* ; Macrophages/immunology* ; RAW 264.7 Cells ; Molecular Structure

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

Digital technologies have become an integral part of complete denture restoration. With advancement in computer-aided design and computer-aided manufacturing (CAD/CAM), tools such as intraoral scanning, facial scanning, 3D printing, and numerical control machining are reshaping the workflow of complete denture restoration. Unlike conventional methods that rely heavily on clinical experience and manual techniques, digital technologies offer greater precision, predictability, and efficacy. They also streamline the process by reducing the number of patient visits and improving overall comfort. Despite these improvements, the clinical application of digital complete denture restoration still faces challenges that require further standardization. The major issues include appropriate case selection, establishing consistent digital workflows, and evaluating long-term outcomes. To address these challenges and provide clinical guidance for practitioners, this expert consensus outlines the principles, advantages, and limitations of digital complete denture technology. The aim of this review was to offer practical recommendations on indications, clinical procedures and precautions, evaluation metrics, and outcome assessment to support digital restoration of complete denture in clinical practice.
Humans ; Denture, Complete ; Computer-Aided Design ; Denture Design/methods* ; Consensus ; Printing, Three-Dimensional

Image 1.

OBJECTIVE: Observational studies have found associations between inflammatory bowel disease (IBD) and the risk of dementia, including Alzheimer's dementia (AD) and vascular dementia (VD); however, these findings are inconsistent. It remains unclear whether these associations are causal. METHODS: We conducted a meta-analysis by systematically searching for observational studies on the association between IBD and dementia. Mendelian randomization (MR) analysis based on summary genome-wide association studies (GWASs) was performed. Genetic correlation and Bayesian co-localization analyses were used to provide robust genetic evidence. RESULTS: Ten observational studies involving 80,565,688 participants were included in this meta-analysis. IBD was significantly associated with dementia (risk ratio [ RR] =1.36, 95% CI = 1.04-1.78; I ² = 84.8%) and VD ( RR = 2.60, 95% CI = 1.18-5.70; only one study), but not with AD ( RR = 2.00, 95% CI = 0.96-4.13; I ² = 99.8%). MR analyses did not supported significant causal associations of IBD with dementia (dementia: odds ratio [ OR] = 1.01, 95% CI = 0.98-1.03; AD: OR = 0.98, 95% CI = 0.95-1.01; VD: OR = 1.02, 95% CI = 0.97-1.07). In addition, genetic correlation and co-localization analyses did not reveal any genetic associations between IBD and dementia. CONCLUSION Our study did not provide genetic evidence for a causal association between IBD and dementia risk. The increased risk of dementia observed in observational studies may be attributed to unobserved confounding factors or detection bias.
Humans ; Mendelian Randomization Analysis ; Inflammatory Bowel Diseases/complications* ; Dementia/etiology* ; Observational Studies as Topic ; Genome-Wide Association Study