Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Twelve compounds were isolated from the rice fermentation extracts of Penicillium expansum GY618 by silica column chromatography, Sephadex gel column chromatography, ODS column chromatography and semi preparative HPLC methods. They were determined as 11-hydroxyl-penicitrinone F (1), penicitrinone F (2), betulin (3), erythrodiol (4), ergosterol (5), ergost-5α,8α-epidioxy-6,22-dien-3β-ol (6), (5α,8α-epidioxy-(22E,24R)-ergosta-6,9(11),22-trien-3β-ol) (7), 5α,8α-epidioxy-(22E,24R)-23-methylergosta-6,22-dien-3β-ol (8), 5α,8α-epidioxy- 23,24(R)-dimethylcholesta-6,9(11),22-trien-3β-ol (9), dankasterone A (10), (17R)-4-hydroxy-17-methylincisterol (11) and ergosta-4,6,8(14),22-tetraen-3-one (12), through mass spectrometer, nuclear magnetic resonance (NMR) and comparison with the literature. Compound 1 was a new compound and compounds 2-4, 6-12 were isolated from Penicillium expansum fungus for the first time. The tyrosinase inhibitory activity experiment showed that compounds 1, 3 and 12 showed certain inhibitory activity against tyrosinase with IC₅₀ values of (75 ± 9), (69 ± 8) and (64 ± 2) μmol·L^-1, respectively. The IC₅₀ of other compounds were all greater than 100 μmol·L^-1, while IC₅₀ of the positive control kojic acid was (46 ± 4) μmol·L^-1.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

ObjectiveThis study aimed to explore the effects of aerobic exercise on cognitive function in aging mice and to elucidate the underlying molecular mechanisms by which aerobic exercise ameliorates cognitive decline through the regulation of gut microbiota-metabolite network. By providing novel insights into the interplay between exercise, gut microbiota, and cognitive health, this research seeks to offer a robust theoretical foundation for developing anti-aging strategies and personalized exercise interventions targeting aging-related cognitive dysfunction. MethodsUsing naturally aged C57BL/6 mice as the experimental model, this study employed a multi-omics approach combining 16S rRNA sequencing and wide-targeted metabolomics analysis. A total of 18 mice were divided into 3 groups: young control (YC, 4-month-old), old control (OC, 21-month-old), and old+exercise (OE, 21-month-old with 12 weeks of moderate-intensity treadmill training) groups. Behavioral assessments, including the Morris water maze (MWM) test, were conducted to evaluate cognitive function. Histopathological examinations of brain tissue sections provided morphological evidence of neuronal changes. Fecal samples were collected for gut microbiota and metabolite profiling via 16S rRNA sequencing and ultra-performance liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (UPLC-QTOF-MS). Data were analyzed using a combination of statistical and bioinformatics tools to identify differentially abundant microbial taxa and metabolites and to construct interaction networks between them. ResultsBehavioral tests revealed that 12 weeks of aerobic exercise significantly improved spatial learning and memory capacity of aged mice, as evidenced by reduced escape latency and increased target area exploration and platform crossings in the MWM. Histopathological analysis demonstrated that exercise mitigated aging-related neuronal damage in the hippocampus, enhancing neuronal density and morphology. 16S rRNA sequencing indicated that exercise increased gut microbiota α‑diversity and enriched beneficial bacterial genera, including Bifidobacterium, Parabacteroides, and Rikenella. Metabolomics analysis identified 32 differentially regulated metabolites between OC and OE groups, with 94 up-regulated and 30 down-regulated in the OE group when compared with OC group. These metabolites were primarily involved in energy metabolism reprogramming (e.g., L-homocitrulline), antioxidant defense (e.g., L-carnosine), neuroprotection (e.g., lithocholic acid), and DNA repair (e.g., ADP-ribose). Network analysis further revealed strong positive correlations between specific bacteria and metabolites, such as Parabacteroides with ADP-ribose and Bifidobacterium with lithocholic acid, suggesting potential neuroprotective pathways mediated by the gut microbiota-metabolite axis. ConclusionThis study provides comprehensive evidence that aerobic exercise elicits cognitive benefits in aging mice by modulating the gut microbiota-metabolite network. These findings highlight three key mechanisms: (1) the proliferation of beneficial gut bacteria enhances metabolic reprogramming to boost DNA repair pathways; (2) elevated neuroinflammation-inhibiting factors reduce neurodegenerative changes; and (3) enhanced antioxidant defenses maintain neuronal homeostasis. These results underscore the critical role of the “microbiota-metabolite-brain” axis in mediating the cognitive benefits of aerobic exercise. This study not only advances our understanding of the gut-brain axis in aging but also offers a scientific basis for developing personalized exercise and probiotic-based interventions targeting aging-related cognitive decline. Future research should further validate these mechanisms in non-human primates and human clinical trials to establish the translational potential of exercise-induced gut microbiota-metabolite modulation for combating neurodegenerative diseases.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

OBJECTIVE: This study aimed to explore the association between body mass index (BMI) and mortality based on the 10-year population-based multicenter prospective study. METHODS: A general population-based multicenter prospective study was conducted at four sites in rural China between 2013 and 2023. Multivariate Cox proportional hazards models and restricted cubic spline analyses were used to assess the association between BMI and mortality. Stratified analyses were performed based on the individual characteristics of the participants. RESULTS: Overall, 19,107 participants with a sum of 163,095 person-years were included and 1,910 participants died. The underweight (< 18.5 kg/m ²) presented an increase in all-cause mortality (adjusted hazards ratio [ aHR] = 2.00, 95% confidence interval [ CI]: 1.66-2.41), while overweight (≥ 24.0 to < 28.0 kg/m ²) and obesity (≥ 28.0 kg/m ²) presented a decrease with an aHR of 0.61 (95% CI: 0.52-0.73) and 0.51 (95% CI: 0.37-0.70), respectively. Overweight ( aHR = 0.76, 95% CI: 0.67-0.86) and mild obesity ( aHR = 0.72, 95% CI: 0.59-0.87) had a positive impact on mortality in people older than 60 years. All-cause mortality decreased rapidly until reaching a BMI of 25.7 kg/m ² ( aHR = 0.95, 95% CI: 0.92-0.98) and increased slightly above that value, indicating a U-shaped association. The beneficial impact of being overweight on mortality was robust in most subgroups and sensitivity analyses. CONCLUSION This study provides additional evidence that overweight and mild obesity may be inversely related to the risk of death in individuals older than 60 years. Therefore, it is essential to consider age differences when formulating health and weight management strategies.
Humans ; Body Mass Index ; China/epidemiology* ; Male ; Female ; Middle Aged ; Prospective Studies ; Rural Population/statistics & numerical data* ; Aged ; Follow-Up Studies ; Adult ; Mortality ; Cause of Death ; Obesity/mortality* ; Overweight/mortality*