AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo investigate the effect and mechanism of Polygonatum neutral polysaccharides from sibiricum （PSP-NP） on colon injury in mice with chronic obstructive pulmonary disease （COPD）. MethodsMale C57BL/6J mice were randomly divided into a control group， a COPD model group， and a PSP-NP group. The COPD model was established using smoke exposure combined with intranasal LPS administration. The PSP-NP group was simultaneously treated daily with 200 mg/kg of PSP-NP via intragastric gavage， while the other groups received an equal volume of saline. HE staining was used to observe the pathological changes in the colon. ELISA was employed to detect the levels of LPS in serum and the expressions of ZO-1， Occludin， IL-6， and TNF-α in colon tissue. UPLC-MS was used to detect the types and contents of bile acids in colonic content， and to screen for differential bile acids. Differential microbial flora were identified using 16S rRNA gene sequencing， and correlation analysis was conducted with differential bile acids. PSP-NP was combined with the differential bile acids cholic acid （CA）， and deoxycholic acid （DCA） in vitro to analyze the binding capacity of PSP-NP for CA and DCA. PSP-NP was applied to NCM460 normal colonic epithelial cells cultured in CA and DCA. Cell migration ability was assessed using the scratch assay， and the mRNA expression levels of inflammatory cytokines TNF-α， IL-6， and NF-κB were measured by RT-qPCR. ResultsPSP-NP effectively improved colonic damage in COPD model mice， enhanced mechanical barrier function， alleviated inflammatory response， and regulated abnormal changes in colonic flora and bile acid metabolism. Correlation analysis further revealed that PSP-NP regulated colonic bile acid metabolism and reduced the redundancy of secondary bile acids by increasing the relative abundance of Bacteroidota， Verrucomicrobiota， Bacteroides， and Akkermansia， while decreasing the relative abundance of Lactobacillus and Bifidobacterium. Notably， in vitro binding assays demonstrated that PSP-NP bound to differential bile acids DCA and CA， with the strongest binding capacity for DCA at 58.2%. In cellular functional studies， DCA inhibited the migration ability of colonic epithelial cells NCM460 and significantly increased the relative mRNA expression levels of inflammatory factors TNF-α， IL-6， and NF-κB. Importantly， co-treatment with PSP-NP significantly ameliorated the impact of DCA on NCM460 cells. ConclusionsPSP-NP may significantly improve colonic damage in COPD model mice. The mechanism may involve the regulation of colonic bile acid metabolism and bile acid profiles through both microbial modulation and direct binding， thereby reducing the damage caused by secondary bile acids such as DCA to colonic epithelial cells.

INTRODUCTION: Radiofrequency ablation (RFA) avoids the complications of general anaesthesia, reduces length of hospitalisation and reduces morbidity from surgery. As such, it is a strong alternative treatment for patients with comorbidities who are not surgical candidates. However, to our knowledge, there have only been 1 systematic review and 3 combined systematic review and meta-analyses on this topic to date. This systematic review and meta-analysis seeks to evaluate the efficacy and safety of RFA in the treatment of papillary thyroid carcinoma (PTC) with longer follow-up durations. METHOD: PubMed, Embase and Cochrane databases were searched for relevant studies published from 1990 to 2021; 13 studies with a total of 1366 patients were included. The Preferred Reporting Items for Systematic reviews and Meta-Analyses guidelines and Sandelowski et al.'s approach1 to "negotiated consensual validation" were used to achieve consensus on the final list of articles to be included. All authors then assessed each study using a rating scheme modified from the Oxford Centre for Evidence-Based Medicine. RESULTS: Pooled volume reduction rates (VRRs) from 1 to 48 months after RFA, complete disappearance rates (CDR) and complications were assessed. Pooled mean VRRs were 96.59 (95% confidence interval [CI] 91.05-102.13, I2=0%) at 12 months2-6 and 99.31 (95% CI 93.74-104.88, I2=not applicable) at 48 months.2,5 Five studies showed an eventual CDR of 100%.2,4,7-9 No life-threatening complications were recorded. The most common complications included pain, transient voice hoarseness, fever and less commonly, first-degree burn. CONCLUSION RFA may be an effective and safe alternative to treating PTC. Larger clinical trials with longer follow-up are needed to further evaluate the effectiveness of RFA in treating PTC.
Humans ; Radiofrequency Ablation/methods* ; Thyroid Cancer, Papillary/surgery* ; Thyroid Neoplasms/surgery* ; Treatment Outcome ; Postoperative Complications/etiology*

Metal ion-promoted chemodynamic therapy(CDT) combined with photodynamic therapy(PDT) offers broad application prospects for enhancing anti-tumor effects. In this study, glycyrrhizic acid(GA), copper ions(Cu~(2+)), and norcantharidin(NCTD) were co-assembled to successfully prepare a natural small-molecule, carrier-free hydrogel(NCTD Gel) with excellent material properties. Under 808 nm laser irradiation, NCTD Gel responded to the tumor microenvironment(TME) and acted as an efficient Fenton reagent and photosensitizer, catalyzing the conversion of endogenous hydrogen peroxide(H_2O_2) within the tumor into oxygen(O_2), and hydroxyl radicals(·OH, type Ⅰ reactive oxygen species) and singlet oxygen(~1O_2, type Ⅱ reactive oxygen species), while depleting glutathione(GSH) to stabilize reactive oxygen species and alleviate tumor hypoxia. In vitro and in vivo experiments demonstrated that NCTD Gel exhibited significant CDT/PDT synergistic therapeutic effects. Further safety evaluation and metabolic testing confirmed its good biocompatibility and safety. This novel hydrogel is not only simple to prepare, safe, and cost-effective but also holds great potential for clinical transformation, providing insights and references for the research and development of metal ion-mediated hydrogel-based anti-tumor therapies.
Hydrogels/chemistry* ; Animals ; Photochemotherapy ; Humans ; Mice ; Antineoplastic Agents/administration & dosage* ; Photosensitizing Agents/chemistry* ; Neoplasms/metabolism* ; Female ; Copper/chemistry* ; Reactive Oxygen Species/metabolism* ; Tumor Microenvironment/drug effects* ; Cell Line, Tumor ; Male

OBJECTIVE: To evaluate the feasibility and short-term effectiveness of three-dimensional (3D)-printed customized porous acetabular components for reconstruction of extensive acetabular bone defects during primary total hip arthroplasty (THA). METHODS: The clinical data of 8 patients with extensive acetabular bone defects, who were treated with 3D-printed individualized porous acetabular components between July 2018 and January 2022, were retrospectively analyzed. The cohort comprised 4 males and 4 females with an average age of 48 years ranging from 34 to 56 years. Acetabular bone defects were classified as Paprosky type ⅢA in 3 cases and type ⅢB in 5 cases. The causes of acetabular destruction were hip tuberculosis (5 cases), pigmented villonodular synovitis (2 cases), and syphilitic arthritis (1 case). Visual analogue scale (VAS) score and Harris hip score (HHS) were used to evaluate the pain relief and hip function before and after operation. Reconstruction outcomes were further assessed by imaging results [X-ray film and Tomosynthesis Shimadzumetal artefact reduction technology (T-SMART)], and the mechanical properties were evaluated by finite element analysis. RESULTS: The operation time ranged from 174 to 195 minutes (mean, 187 minutes), and intraoperative blood loss ranged from 390 to 530 mL (mean, 465 mL). All 8 patients were follow-up 26-74 months (mean, 44 months). Among the 5 patients with tuberculosis, none experienced postoperative recurrence. At last follow-up, the VAS score was 0.3±0.5 and the HHS score was 87.9±3.7, both significantly improved compared to preoperative values ( t=25.170, P<0.001; t=-28.322, P<0.001). X-ray films at 2 years after operation demonstrated satisfactory matching between the 3D-printed customized acetabular component and the acetabulum. The postoperative center of rotation of the operated hip was shifted by (2.1±0.5) mm horizontally and (2.0±0.7) mm vertically relative to the contralateral side, with both offsets showing significant differences compared to preoperative values ( t=24.700, P<0.001; t=55.230, P<0.001). T-SMART imaging showed satisfactory osseointegration at the implant-host bone interface. No complications such as aseptic loosening or screw breakage was observed during follow-up. Finite element analysis showed that the acetabular component had good mechanical properties. CONCLUSION The application of 3D-printed individualized porous acetabular components in the reconstruction of extensive acetabular bone defects demonstrated precise anatomical reconstruction, stable mechanical support, and good functional performance in short-term follow-up, offering a potential alternative for acetabular defect reconstruction in primary THA.
Humans ; Middle Aged ; Male ; Female ; Printing, Three-Dimensional ; Arthroplasty, Replacement, Hip/instrumentation* ; Acetabulum/diagnostic imaging* ; Adult ; Follow-Up Studies ; Retrospective Studies ; Hip Prosthesis ; Prosthesis Design ; Porosity ; Treatment Outcome ; Plastic Surgery Procedures/methods*

Immune checkpoint inhibitors (ICIs) have been approved for the treatment of a variety of solid tumors and hematological malignancies. Adverse reactions caused by ICIs have been gradually focused on. Cytomegalovirus (CMV) gastritis after ICIs treatment is relatively rare. Here we reported a case of advanced lung adenocarcinoma who experienced recurrent upper abdominal pain and vomiting after Pembrolizumab treatment. CMV gastritis was diagnosed through gastroscopy. The patient's symptoms improved after antiviral treatment. During the treatment of ICIs, attention should be paid to the differential diagnosis of upper abdominal pain symptoms, and vigilance should be maintained against CMV gastritis. It is difficult to differentiate CMV gastritis and immune-related gastritis judging from symptoms, and gastroscopy is important for differential diagnosis.
.
Humans ; Adenocarcinoma of Lung/drug therapy* ; Cytomegalovirus/physiology* ; Cytomegalovirus Infections ; Gastritis/diagnosis* ; Immune Checkpoint Inhibitors/therapeutic use* ; Lung Neoplasms/drug therapy*

BACKGROUND: Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese. METHODS: Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics. RESULTS: The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05). CONCLUSIONS In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.

OBJECTIVE: To evaluate the efficacy and safety of a hospital-made resuscitation pack, a Chinese medicinal herbal compound formula designed to enhance recovery in post-bronchoscopy patients. METHODS: In this randomized, single-blind, placebo-controlled clinical trial, eligible patients were randomly assigned 1:1 to either the treatment or control groups. The patients in the treatment group applied the resuscitation pack, which contained aromatic compounded Chinese herbs. The patients in the control group applied a hospital-made, single herb placebo pack. Packs were placed on the Tiantu (CV 22) acupuncture point for 4 h as soon as the bronchoscopy finished. Efficacy indicators, such as recovery time, patients' symptoms including nausea and dizziness, and adverse events (AEs) were observed and compared. The outcome indices were evaluated at baseline, 1 and 24 h after the bronchoscopy. Subgroup analysis was further performed by patients' age and depth of sedation. RESULTS: When applying generalized estimating equations (GEE) to evaluate the intensity of post-bronchoscopy nausea and vomiting, the intensity was lower in the treatment group (163 cases) compared with the control group (162 cases; 95% CI: 0.004, 0.099, P=0.03]. Also, significantly lower intensity of nausea was observed in the 60-70 years of age subgroup (95% CI: 0.029, 0.169, P=0.006) and deep sedation subgroup (95% CI: 0.002, 0.124; P=0.04). There was no significant difference in dizziness between two groups by GEE (95% CI: -0.134, 0.297; P=0.459). In addition, no serious AEs were observed in either group. CONCLUSIONS Our study found that the resuscitation pack markedly improved patients' symptoms by reducing nausea and vomiting after bronchoscopy without AEs, compared with placebo in the perioperative period. (Trial registration No. ChiCTR2000038299).
Humans ; Male ; Middle Aged ; Female ; Bronchoscopy/adverse effects* ; Single-Blind Method ; Aged ; Drugs, Chinese Herbal/adverse effects* ; Treatment Outcome ; Resuscitation ; Adult ; Medicine, Chinese Traditional

OBJECTIVE: To investigate the anti-inflammatory effect of rutaecarpine (RUT) on monosodium urate crystal (MSU)-induced murine peritonitis in mice and further explored the underlying mechanism of RUT in lipopolysaccharide (LPS)/MSU-induced gout model in vitro. METHODS: In MSU-induced mice, 36 male C57BL/6 mice were randomly divided into 6 groups of 8 mice each group, including the control group, model group, RUT low-, medium-, and high-doses groups, and prednisone acetate group. The mice in each group were orally administered the corresponding drugs or vehicle once a day for 7 consecutive days. The gout inflammation model was established by intraperitoneal injection of MSU to evaluate the anti-gout inflammatory effects of RUT. Then the proinflammatory cytokines were measured by enzyme-linked immunosorbent assay (ELISA) and the proportions of infiltrating neutrophils cytokines were detected by flow cytometry. In LPS/MSU-treated or untreated THP-1 macrophages, cell viability was observed by cell counting kit 8 and proinflammatory cytokines were measured by ELISA. The percentage of pyroptotic cells were detected by flow cytometry. Respectively, the mRNA and protein levels were measured by real-time quantitative polymerase chain reaction (qRT-PCR) and Western blot, the nuclear translocation of nuclear factor κB (NF-κB) p65 was observed by laser confocal imaging. Additionally, surface plasmon resonance (SPR) and molecular docking were applied to validate the binding ability of RUT components to tumor necrosis factor α (TNF-α) targets. RESULTS: RUT reduced the levels of infiltrating neutrophils and monocytes and decreased the levels of the proinflammatory cytokines interleukin 1β (IL-1β) and interleukin 6 (IL-6, all P<0.01). In vitro, RUT reduced the production of IL-1β, IL-6 and TNF-α. In addition, RT-PCR revealed the inhibitory effects of RUT on the mRNA levels of IL-1β, IL-6, cyclooxygenase-2 and TNF-α (P<0.05 or P<0.01). Mechanistically, RUT markedly reduced protein expressions of tumor necrosis factor receptor (TNFR), phospho-mitogen-activated protein kinase (p-MAPK), phospho-extracellular signal-regulated kinase, phospho-c-Jun N-terminal kinase, phospho-NF-κB, phospho-kinase α/β, NOD-like receptor thermal protein domain associated protein 3 (NLRPS), cleaved-cysteinyl aspartate specific proteinase-1 and cleaved-gasdermin D in macrophages (P<0.05 or P<0.01). Molecularly, SPR revealed that RUT bound to TNF-α with a calculated equilibrium dissociation constant of 31.7 µmol/L. Molecular docking further confirmed that RUT could interact directly with the TNF-α protein via hydrogen bonding, van der Waals interactions, and carbon-hydrogen bonding. CONCLUSION RUT alleviated MSU-induced peritonitis and inhibited the TNFR1-MAPK/NF-κB and NLRP3 inflammasome signaling pathway to attenuate gouty inflammation induced by LPS/MSU in THP-1 macrophages, suggesting that RUT could be a potential therapeutic candidate for gout.
Animals ; NF-kappa B/metabolism* ; Male ; Indole Alkaloids/therapeutic use* ; Signal Transduction/drug effects* ; Mice, Inbred C57BL ; Inflammation/complications* ; Uric Acid ; Quinazolines/therapeutic use* ; NLR Family, Pyrin Domain-Containing 3 Protein/metabolism* ; Humans ; Gout/chemically induced* ; Inflammasomes/metabolism* ; Cytokines/metabolism* ; THP-1 Cells ; Mitogen-Activated Protein Kinases/metabolism* ; Mice ; Molecular Docking Simulation ; Lipopolysaccharides ; Quinazolinones

Immunotherapy has emerged as a revolutionary approach to treat immune-related diseases. Dendritic cells (DCs) play a pivotal role in orchestrating immune responses, making them an attractive target for immunotherapeutic interventions. Modulation of gene expression in DCs using genome editing techniques, such as the CRISPR-Cas system, is important for regulating DC functions. However, the precise delivery of CRISPR-based therapies to DCs has posed a significant challenge. While lipid nanoparticles (LNPs) have been extensively studied for gene editing in tumor cells, their potential application in DCs has remained relatively unexplored. This study investigates the important role of cholesterol in regulating the efficiency of BAMEA-O16B lipid-assisted nanoparticles (BLANs) as carriers of CRISPR/Cas9 for gene editing in DCs. Remarkably, BLANs with low cholesterol density exhibit exceptional mRNA uptake, improved endosomal escape, and efficient single-guide RNA release capabilities. Administration of BLAN_mCas9/gPD-L1 results in substantial PD-L1 gene knockout in conventional dendritic cells (cDCs), accompanied by heightened cDC1 activation, T cell stimulation, and significant suppression of tumor growth. The study underscores the pivotal role of cholesterol density within LNPs, revealing potent influence on gene editing efficacy within DCs. This strategy holds immense promise for the field of cancer immunotherapy, offering a novel avenue for treating immune-related diseases.