ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics， and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography （UPLC） fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry （UPLC-MS/MS） technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated， and 23 of them were identified and assigned. In 27 batches of Naomaili granules， the mass fractions of 14 components that were stachydrine hydrochloride， leonurine hydrochloride， calycosin-7-O-glucoside， calycosin，tanshinoneⅠ， cryptotanshinone， tanshinoneⅡ_A， ginsenoside Rb₁， notoginsenoside R₁， ginsenoside Rg₁， paeoniflorin， albiflorin， lactiflorin， and salvianolic acid B were found to be 2.902-3.498， 0.233-0.343， 0.111-0.301， 0.07-0.152， 0.136-0.228， 0.195-0.390， 0.324-0.482， 1.056-1.435， 0.271-0.397， 1.318-1.649， 3.038-4.059， 2.263-3.455， 0.152-0.232， 2.931-3.991 mg∙g^-1， respectively. Multivariate statistical analysis showed that paeoniflorin， ginsenoside Rg₁， ginsenoside Rb₁ and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them， salvianolic acid B and ginsenoside Rb₁ had strong anti-inflammatory activity， with IC₅₀ values of （36.11±0.15） mg∙L^-1 and （27.24±0.54） mg∙L^-1， respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out， and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To fabricate a hydrogel loaded with inositol hexaphosphate-zinc and preliminarily evaluate its performance in self-mineralization and osteoinduction, thereby providing a theoretical basis for the development of bone regeneration materials. Methods: The hydrogel framework (designated DF0) was formed by copolymerizing methacryloyloxyethyltrimethylammonium chloride and four-armed poly(ethylene glycol) acrylate, followed by sequentially loading inositol hexaphosphate anions via electrostatic interaction and zinc ions via chelation. The hydrogel loaded only with inositol hexaphosphate anions was named DF1, while the co-loaded hydrogel was named DF2. The self-mineralization efficacy of the DF0 , DF1 and DF2 hydrogels was characterized using scanning electron microscopy, transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and selected area electron diffraction (SAED). The biocompatibility was assessed via live/dead cell staining and a CCK-8 assay. The osteoinductive capacity of the DF0 , DF1 and DF2 hydrogels on MC3T3-E1 cells was assessed via alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining. In the aforementioned cell experiments, cells cultured in standard medium served as the control group Results: The DF0, DF1, and DF2 hydrogels were successfully synthesized. Notably, DF1 and DF2 exhibited distinct self-mineralization within 6 days. Results from TEM, EDS, and SAED confirmed that the mineralization products were amorphous calcium phosphate in group DF1, and amorphous calciumzinc phosphate in group DF2. Biocompatibility tests revealed that none of the hydrogels (DF0, DF1, and DF2) adversely affected cell viability or proliferation. In osteogenic induction experiments, both ALP and ARS staining were intensified in the DF1 and DF2 groups, with the most profound staining observed in the DF2 group. Conclusion The developed inositol hexaphosphate-zinc hydrogel (DF2) demonstrates the dual capacity to generate calcium-phosphate compounds through self-mineralization while exhibiting excellent osteoinductive properties. This biocompatible, dual-promoting osteogenic hydrogel presents a novel strategy for bone regeneration.

OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 （PCSK9） inhibitors in China， including evolocumab， tafolecimab， recaticimab， ebronucimab， ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions （second edition）， drug instructions， clinical diagnosis and treatment guidelines， and literature for six drugs were retrieved from CNKI， Wanfang Data， VIP， PubMed， Embase， Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects： pharmaceutical characteristics， effectiveness， safety， economy， and other attributes. RESULTS The pharmaceutical characteristics， effectiveness， safety， economy， other attributes， and total score of evolocumab scored 24， 27， 15.7， 10， 5.3， and 82 points， respectively. Tafolecimab scored 23.5， 23， 11.5， 9.97， 4.6， and 72.57 points， respectively. Recaticimab scored 20.5， 22， 15.5， 6.37， 3.5， and 67.87 points. Ebronucimab scored 20， 23， 11， 6.48， 3.5， and 63.98 points. Ongericimab scored 20.5， 23， 8.5， 4.83， 3.5， and 60.33 points. Inclisiran scored 25.5， 24， 13， 6.48， 5， and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option， and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.

OBJECTIVE To evaluate the cost-effectiveness of cefiderocol versus best available therapy （BAT） or standard-of- care （SOC） for the treatment of confirmed or suspected carbapenem-resistant Gram-negative bacterial （CRGNB） serious infections from the perspective of the Chinese healthcare system， and to explore its reasonable pricing. METHODS A decision tree model was constructed based on data from two phase Ⅲ clinical trials （CREDIBLE-CR and GAME CHANGER） to simulate the cost- effectiveness of cefiderocol in two scenarios： salvage therapy for confirmed CRGNB infection （scenario 1） and empirical therapy for suspected CRGNB infection （scenario 2）. The primary outcome measure was the incremental cost-effectiveness ratio （ICER）. The willingness-to-pay （WTP） was set at 1 to 3 times China’s per capita GDP in 2024. To verify the robustness of the results， one- way and probabilistic sensitivity analyses were conducted， and based on these， a reasonable price range for cefiderocol in the Chinese market was explored. RESULTS The results for scenario 1 showed that the clinical cure rate in the cefiderocol group was higher than that in the BAT group （47.50% vs. 34.21%）， but its ICER was 415 065.03 yuan per cured case， exceeding three times China’s GDP per capita. Scenario 2 revealed that the ICER for cefiderocol relative to SOC was as high as 1 362 446.16 yuan per cured case， far exceeding the WTP. Sensitivity analysis indicated that the treatment duration and price of cefiderocol were key factors affecting its cost-effectiveness. In the two scenarios described above， the unit price of cefiderocol must fall below 683.47 and 242.00 yuan/g， respectively， to be considered cost-effective. CONCLUSIONS Based on the current market price， cefiderocol lacks sufficient cost-effectiveness for treating confirmed or suspected CRGNB serious infections within China’s healthcare system. To improve its accessibility， price negotiations or a tiered medical insurance payment strategy are required.

Objective: Several miRNAs have been identified as differentially expressed in patients with poor ovarian response (POR) compared to those with normal responses. This study aims to assess the potential of serum miR-329-3p as a biomarker for diagnosing POR. Methods: We conducted a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis to confirm the target genes of miR-329-3p. KGN cells were transfected with both miR-329-3p mimic and inhibitor to assess the differential expression of these target genes. In accordance with the Bologna criteria, we enrolled 16 control patients and 16 patients with POR. We collected patient samples, including serum from day 2 and the human chorionic gonadotropin (hCG) day, as well as granulosa and cumulus cells, to validate the expression of miR-329-3p using quantitative real-time polymerase chain reaction. Results: KEGG pathway analysis revealed that miR-329-3p targeted adenylyl cyclase 9 (ADCY9) and protein kinase A subunit beta (PRKACB), both of which are involved in ovarian steroidogenesis. In KGN cells treated with a miR-329-3p mimic, ADCY9 and PRKACB expression levels were significantly reduced (p<0.05). Elevated levels of miR-329-3p suppressed aromatase expression and 17β-estradiol production by modulating ADCY9 and PRKACB in KGN cells. These effects were also observed in POR patients. Follicle-stimulating hormone receptor (FSHR) expression was diminished in the granulosa cells of POR patients. On day 2, on hCG day, and in granulosa cells, miR-329-3p exhibited high expression levels in the serum of POR patients. Conclusion miR-329-3p exhibited increased expression in granulosa cells and in the sera of POR patients. Consequently, we propose that miR-329-3p may be a potential biomarker for the diagnosis of POR.

The creation of self-organizing liver organoids represents a significant, although modest, step toward addressing the ongoing organ shortage crisis in allogeneic liver transplantation. However, researchers have recognized that achieving a fully functional whole liver remains a distant goal, and the original ambition of organoid-based liver generation has been temporarily put on hold. Instead, liver organoids have revolutionized the field of hepatology, extending their influence into various domains of precision and molecular medicine. These 3D cultures, capable of replicating key features of human liver function and pathology, have opened new avenues for human-relevant disease modeling, CRISPR gene editing, and high-throughput drug screening that animal models cannot accomplish. Moreover, advancements in creating more complex systems have led to the development of multicellular assembloids, dynamic organoid-on-chip systems, and 3D bioprinting technologies. These innovations enable detailed modeling of liver microenvironments and complex tissue interactions. Progress in regenerative medicine and transplantation applications continues to evolve and strives to overcome the obstacles of biocompatibility and tumorigenecity. In this review, we examine the current state of liver organoid research by offering insights into where the field currently stands, and the pivotal developments that are shaping its future.

The initial molecular cytogenetic characteristics of blasts plays a significant role in determining the treatment course of B-cell acute lymphoblastic leukemia (B-ALL).B-ALL with intrachromosomal amplification of chromosome 21 (iAMP21) has been well known to have unfavorable prognosis. Also, there are previously recognized germline mutations that increase the risk of ALL, such as trisomy 21, Down syndrome. This case report is about a 16-year-old girl who presented with lymphadenitis, purpura, and fever followed by initial lab of elevated white blood cell with blasts.She had some notable facial features, but no typical Down syndrome related one.Bone marrow biopsy and fluorescence in situ hybridization finalized the diagnosis as B-ALL with iAMP21, high-risk group. The minimal residual disease-negative complete remission was achieved after the induction chemotherapy with Korean multicenter high-risk protocol. However, abnormal karyotype was sustained in bone marrow. Microarrays with her buccal swab raised the possibility that the abnormal karyotype was not from the leukemic blasts but rather from the germline. Although she underwent scheduled chemotherapy uneventfully as slow early responder type, thrombocytopenia and abnormal karyotype persisted, leading to the diagnosis of acute myeloid leukemia. Additional chemotherapy and peripheral blood stem cell transplantation was performed which resulted in engraftment. This case highlights the discovery of a constitutional genetic aberration, which played like a silent yet critical background factor for B-ALL with iAMP21. As the number of reported cases are limited, the role of germline chromosome 21 mutation as the indicator for prognosis of B-ALL should be studied further.