Objective To clarify the expression and clinicopathological significances of mTOR and Merlin proteins in spinal schwannoma.Methods Immunohistochemical SP method was used to detect the expression levels of mTOR and Merlin proteins in tumor tissues from 21 spinal schwannoma patients.The meaning of the two proteins expression changes on schwannoma was analyzed.Results In 21 cases of schwannoma patients,the mTOR was positive expression in 16 cases,negative expression in 5 cases,while in the normal neural tissue,mTOR was all negative expression.In 21 cases of schwannoma patients,the Merlin protein was negative expression in 18 cases,positive expression in 3 cases,but it was positive in all of normal neural tissue.Merlin protein expression was negatively correlated with mTOR protein expression (r =-0.785,P ＜ 0.001).Conclusion The expression level of mTOR proteins in schwannoma is significantly higher than that in normal nerve tissue,while the expression level of Merlin protein in schwannoma tissue is significantly lower than that in normal nerve tissue.There is an internal relationship between mTOR and Merlin.

Objective:To study the early application of color duplex ultrasound in the evaluation of the arteriosclerosis occlusion after operation.Methods:we retrospectively divided the patients with atherosclerotic occlusion after open crossover surgery and endovascular treatment into groups 1( 12 patients ) and group 2( 13 patients ) respectively.In group 1,we assessed the relationship between the separated results of MG and the volume flow measurement in out-flow arteries before and after operation.In group 2,we assessed the relationship between the volume flow measurement in out-flow arter ies and the result of the DSA examination and all the data of group 2 is after treatment.Results:In group 1,the correlation of the separated results of MG and the increased amplitude of volume flow measurement in out-flow arteries was negative(P=0.0138,r=-0.6859).In group 2,the correlation of the volume flow measurement in out-flow arteries and the result of the DSA examination was negative(P=0.0316,r=-0.6198).In the patients after open crossover surgery and endovascular treatment,the MG and the volume of out-flow arteries were the significant hemodynamics index respectively.Conclusion:The color duplex ultrasonic early application is a perfect method in the follow-up of arteriosclerosis occlusion after operation.

Objective To assess reconstructive options for critical limb ischaemia in infrapopliteal arteries. Methods A retrospective review of all CLI patients who underwent infrapopliteal reconstruction was carried out. Patient history, demographics, procedure details, complications, and follow-up information were collected and analyzed. Patency, limb salvage rate was determined by Kaplan-Meier analysis. Results During the period (from December 2003 to January 2008 ), 123 CLI patients with arteriosclerosis occlusions were treated on an intention-to-treat basis with infrapopliteal percutaneous transluminal angioplasty (PTA).Thirty-three thromboangiitis obliterans and twenty-three arteriosclerosis occlusions suffering CLI were treated by infrapopliteal bypass procedures. Primary patency and limb salvage rate of infrapopliteal PTA at 6, 12 and 24 months was 67%, 54%, 49% and 91%, 85%, 78% respectively, Primary patency and limb salvage rate of infrapopliteal surgical bypass at 6, 12 and 24 months was 90%, 83%, 79% and 92%,87%, 80% respectively, the patency of infrapopliteal PTA was lower than infrapopliteal surgical bypass (P ＜0. 01 ), but the limb salvage rate of infrapopliteal PTA and open surgery was no significant difference (P ＞ 0. 05 ). Conclusion Endovascular treatment (PTA) in patients with infrapopliteal arteriosclerosis occlusions and critical ischaemia is safe, effective. Infrapopliteal PTA can be used as the choice of therapy and surgical bypass reserved in those endovascular treatment failed. While in CLI patients with thromboangiitis obliterans infrapopliteal artery bypass remains the best treatment option.

At present,the standardized training of neurosurgery resident is in the primary stage in our country,and the master's degree postgraduates of Neurosurgery major are the main part of the students of neurosurgery planning training in our department.At present,a systematic and sound training system and teaching mechanism hasn't been formed in the standardized training of postgraduates in Neurosurgery.It is imperative to explore the training mode of postgraduates majoring in neurosurgery to keep pace with the times and meet the needs of the society.Based on the problems in the current training mode of neurosurgery in the First Affiliated Hospital of Heavy Medicine and combined with the existing problems,this paper focuses on the cultivation of professional basic theoretical knowledge,clinical practice ability,clinical thinking and innovative ability and aims to establish professional assessment team,so as to boost the education development of postgraduates with neurosurgery degree and improve the quality of standardized training.

Background: African swine fever virus (ASFV), classical swine fever virus (CSFV), and porcine reproductive and respiratory syndrome virus (PRRSV) are still prevalent in many regions of China. Co-infections make it difficult to distinguish their clinical symptoms and pathological changes. Therefore, a rapid and specific method is needed for the differential detection of these pathogens. Objectives: The aim of this study was to develop a multiplex real-time quantitative reverse transcription polymerase chain reaction (multiplex qRT-PCR) for the simultaneous differential detection of ASFV, CSFV, and PRRSV. Methods: Three pairs of primers and TaqMan probes targeting the ASFV p72 gene, CSFV 5′untranslated region, and PRRSV ORF7 gene were designed. After optimizing the reaction conditions, including the annealing temperature, primer concentration, and probe concentration, multiplex qRT-PCR for simultaneous and differential detection of ASFV, CSFV, and PRRSV was developed. Subsequently, 1,143 clinical samples were detected to verify the practicality of the assay. Results: The multiplex qRT-PCR assay could specifically and simultaneously detect the ASFV, CSFV, and PRRSV with a detection limit of 1.78 × 10 0 copies for the ASFV, CSFV, and PRRSV, but could not amplify the other major porcine viruses, such as pseudorabies virus, porcine circovirus type 1 (PCV1), PCV2, PCV3, foot-and-mouth disease virus, porcine parvovirus, atypical porcine pestivirus, and Senecavirus A. The assay had good repeatability with coefficients of variation of intra- and inter-assay of less than 1.2%. Finally, the assay was used to detect 1,143 clinical samples to evaluate its practicality in the field. The positive rates of ASFV, CSFV, and PRRSV were 25.63%, 9.36%, and 17.50%, respectively. The co-infection rates of ASFV+CSFV, ASFV+PRRSV, CSFV+PRRSV, and ASFV+CSFV+PRRSV were 2.45%, 2.36%, 1.57%, and 0.17%, respectively. Conclusions The multiplex qRT-PCR developed in this study could provide a rapid, sensitive, specific diagnostic tool for the simultaneous and differential detection of ASFV, CSFV, and PRRSV.

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics