1.Effect of problem-based learning on theoretical knowledge of Chinese nursing students:a Meta-analysis
Jufeng YE ; Hua LI ; Zhifeng ZHOU ; Wenzhi CAI
Chinese Journal of Medical Education Research 2014;(1):21-25
Objective To evaluate the theoretical knowledge level of Chinese nursing students based on the problem-based learning(PBL)versus traditional teaching methods. Methods Databases including CNKI (1979-2013.03),VIP (1989-2013.03)and Wanfang (1982-2013.03)were searched (up to March,2013)for controlled studies comparing PBL and traditional teaching methods. The quality of included studies was critically evaluated and the data were analyzed by Stata 10.0 software. Results A total of 659 articles were retrieved but only 22 were included. Meta-analyses showed that there were significant differences between PBL and traditional teaching methods in improving theoreti-cal knowledge of nursing students(SMD merge=0.79,95%CI(0.55,1.03),P=0.000). Conclusions PBL can improve the theoretical scores of Chinese nursing students. However,the above conclusion needs to be confirmed by more large-scale randomized controlled trials of higher quality due to the limitation of studies include in this paper.
2.Effect of Edelfosine on the Proliferation of Hela Cells and Its Mechanism
Hui ZHANG ; Liping YU ; Jufeng ZHOU ; Dugui HE ; Linzhen LI ; Bin WANG ; Tongxiu LUO ; Qiangguo LI
China Pharmacy 2005;0(22):-
OBJECTIVE:To investigate the effect of edelfosine on the proliferation of Hela cells and its mechanism.METHODS:Hela cells were treated with edelfosine at doses of 0(control),0.5,1.0,5.0,10.0 ?mol?L-1 for 96 h.MTT assay,flow cytometry,and staining were performed to determine the cell proliferation activity,cell cycle,and apoptotic rate.RESULTS:As compared with control,the cell proliferation activity of Hela cells was inhibited in a dose-and time-dependent manner after being treated by edelfosine for 24~96 h.After being treated by edelfosine(1.0,5.0,10.0 ?mol?L-1) for 72 h,the number of Hela cells significantly increased in G0/G1 phase but decreased in S phase(P
3.Rapid simultaneous determination of main nucleosides in Cordyceps sinensis with LC-ESI-MS.
Jufeng ZHOU ; Lanfang HUANG ; Fangqiu GUO
China Journal of Chinese Materia Medica 2009;34(18):2349-2352
OBJECTIVETo establish an LC-MS method for rapid simultaneous determination of adenine,adenosine and cordycepin in Cordyceps sinensis.
METHODAn electrospray ionization (ESI) interface and selective ion monitoring (SIM) mode were used. The analytical column was a Shimadzu VP-ODS column (2.0 mm x 150 mm) and the mobile phase was water-methanol-formic acid (92:7:1). Methanol was used as extraction solvent and 2-chloroadenosine was used as internal standard for this assay.
RESULTThe regression equations and coefficient were Y = 0.07264X + 0.00622 and r = 0.9987 for adenine, Y = 0.1597X + 0.0146 and r = 0.9991 for adenosine, Y = 0.1942X + 0.0186 and r = 0.9994 for cordycepin. The linear range was 0.8-130.0 mg x L(-1), 0.5 - 124.5 mg x L(-1) and 0.5-128.5 mg x L(-1) for adenine, adenosine and cordycepin, respectively. The average recovery was 98.76%, 99.37% and 99.26% for adenine, adenosine and cordycepin, respectively.
CONCLUSIONThis established method was highly sensitive, fast and selective, which can be used for rapid simultaneous determination of adenine, adenosine and cordycepin in C. sinensis. This method also can be applied for the quality control of C. sinensis.
Animals ; Chromatography, Liquid ; methods ; Cordyceps ; chemistry ; Moths ; chemistry ; Nucleosides ; chemistry ; Sensitivity and Specificity ; Spectrometry, Mass, Electrospray Ionization ; methods
4.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
5.Application of psychological nursing in treatment of patients with malignant tumor chemotherapy
Jufeng GU ; Hongfang YAO ; Weixia JIANG ; Dandan ZHOU ; Jinye HE ; Lina KUAI
Journal of Clinical Medicine in Practice 2015;(20):47-49
ABSTRACT:Objective To explore the application value of psychological nursing in treatment of patients with malignant tumor chemotherapy.Methods A total of 105 patients with malignant tumor chemotherapy were randomly divided into intervention group (52 cases)and control group (53 cases).Control group was treated with routine nursing,on this basis intervention group was added with psychological nursing,including evaluation of psychological condition,establishment of favorable nurse-patient relationship,regular communication,optimization of patients’social sup-port network and relaxation training,etc.Results After nursing,self-rating anxiety scale (SAS) and self-rating depression scale (SDS)scores of both groups decreased significantly,which were significantly lower in intervention group than control group (P <0.01).After nursing,there were no significant differences in role function,emotional function and social function in intervention group when compared with nursing before (P >0.05),but the scores of rest programs of European Organization Research and Treatment of Cancer (EORTC)Quality of Life Questionnaire (QLQ)-30 decreased significantly than nursing before (P <0.01),and intervention group was significantly lower in each score of above programs than control group (P <0.05 or P <0.01).Conclusion Psychological nursing can effectively improve the psychological condition,reduce negative emotions and improve the quality of life in patients with malignant tumor chemotherapy.
6.Application of psychological nursing in treatment of patients with malignant tumor chemotherapy
Jufeng GU ; Hongfang YAO ; Weixia JIANG ; Dandan ZHOU ; Jinye HE ; Lina KUAI
Journal of Clinical Medicine in Practice 2015;(20):47-49
ABSTRACT:Objective To explore the application value of psychological nursing in treatment of patients with malignant tumor chemotherapy.Methods A total of 105 patients with malignant tumor chemotherapy were randomly divided into intervention group (52 cases)and control group (53 cases).Control group was treated with routine nursing,on this basis intervention group was added with psychological nursing,including evaluation of psychological condition,establishment of favorable nurse-patient relationship,regular communication,optimization of patients’social sup-port network and relaxation training,etc.Results After nursing,self-rating anxiety scale (SAS) and self-rating depression scale (SDS)scores of both groups decreased significantly,which were significantly lower in intervention group than control group (P <0.01).After nursing,there were no significant differences in role function,emotional function and social function in intervention group when compared with nursing before (P >0.05),but the scores of rest programs of European Organization Research and Treatment of Cancer (EORTC)Quality of Life Questionnaire (QLQ)-30 decreased significantly than nursing before (P <0.01),and intervention group was significantly lower in each score of above programs than control group (P <0.05 or P <0.01).Conclusion Psychological nursing can effectively improve the psychological condition,reduce negative emotions and improve the quality of life in patients with malignant tumor chemotherapy.
7.α-Hederin Induces Apoptosis in Hepato-cellular Carcinoma Cells by Activating and Stabilizing p53/Noxa Signaling Pathway
Xiaojing CHEN ; Li ZHOU ; Kaiqi LIU ; Jufeng DUAN ; Ming LIU ; Hongliang LI ; Xuanbin WANG
Herald of Medicine 2024;43(3):334-345
Objective To investigate the inhibitory effects and mechanisms of α-hederin,an active ingredient in Fruc-tus Akebiae,on hepatocellular carcinoma(HCC)cells.Methods HCC cells were divided into four groups and treated with α-hederin(0,10,20,and 30 μmol·L-1)for 24 h and 48 h,respectively.MTT assays were used to detect the cell proliferation rate,flow cytometry(FCM)was used to detect the apoptotic rate,transcriptomics was used to screen signaling pathways in α-hederin-treated HCC cells,RNA interference was exploited to verify the underlying signaling pathway,and real-time quantitative PCR(qRT-PCR)and Western blotting(WB)were used to detect expression changes of the mRNA and protein of TP53(p53),PMAIP1(Noxa),and apoptosis-associated proteins,Caspase9 and Caspase3.Results α-Hederin induced apoptosis by activa-ting apoptosis-associated proteins,PARP,Caspase9 and Caspase3.Transcriptomics,qRT-PCR,and WB results also showed that α-hederin increased the mRNA and protein expression of p53 and Noxa.Furthermore,α-hederin inhibited the protein degradation of p53 and Noxa,reversing the apoptosis decrease in p53/Noxa siRNA-knocked-down HCC cells.In vivo results showed that α-hederin inhibited the growth of HCC tumors.Conclusion α-hederin may induce the apoptosis of HCC cells by activating and stabilizing the p53/Noxa signaling pathway.
8.Analysis of risk factors for post-prematurity respiratory disease in very preterm infants
You YOU ; Jingwen LYU ; Lin ZHOU ; Liping WANG ; Jufeng ZHANG ; Li WANG ; Yongjun ZHANG ; Hongping XIA
Chinese Journal of Pediatrics 2025;63(1):50-54
Objective:To investigate the risk factors associated with post-prematurity respiratory disease (PPRD) in very preterm infants.Methods:A prospective cohort study was conducted, enrolling 369 very preterm infants who were admitted to the neonatal intensive care unit of Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, within one week of birth from January 2019 to June 2023. Data on maternal and infant clinical characteristics, neonatal morbidities, and treatments during hospitalization were collected. The very preterm infants were divided into 2 groups based on whether they developed PPRD. Continuous variables were compared using Mann-Whitney U test, while categorical variables were compared using χ2 tests or continuity correction χ2 test. Multivariate Logistic regression analysis was used to identify the independent risk factors for PPRD in very preterm infants. Results:Among the 369 very preterm infants, 217 cases(58.8%) were male, with a gestational age of 30 (28, 31) weeks at birth and a birth weight of 1 320 (1 085, 1 590) g. Of these, 116 cases (31.4%) developed PPRD, while 253 cases (68.6%) did not. The very preterm infants in the PPRD group had a lower gestational age and lower birth weight (both, P<0.001). The PPRD group also had a higher proportion of males, lower Apgar scores at the 1 th minute after birth and the 5 th minutes after birth, a higher rate of born via cesarean delivery, and a higher incidence of bronchopulmonary dysplasia, more pulmonary surfactant treatment, longer durations of mechanical ventilation, longer total oxygen therapy, and lower Z-score for weight at discharge (all P<0.05). Multivariate Logistic regression analysis showed that gestational age ( OR=0.85, 95% CI 0.73-0.99, P=0.037), born via cesarean delivery ( OR=2.23, 95% CI 1.21-4.10, P=0.010), a duration of mechanical ventilation ≥7 days ( OR=2.51, 95% CI 1.43-4.39, P=0.001), and a Z-score for weight at discharge ( OR=0.82, 95% CI 0.67-0.99, P=0.040) were all independent risk factors for PPRD in very preterm infants. Conclusion:Very preterm infants with a small gestational age, born via cesarean section, mechanical ventilation ≥7 days, and a low Z-score for weight at discharge should be closely monitored for PPRD, and provided with standardized respiratory management after discharge.
9.Clinical Observation of Recombinant Human Interferon Gel Combined with Baofukang Suppository in the Treat- ment of Cervical High-risk HPV Infection
Xiaoyu SU ; Liping MENG ; Congcong ZOU ; Jufeng ZHOU ; Fang WANG ; Manling CHEN
China Pharmacy 2020;31(8):984-988
OBJECTIVE:To inv estigate therapeutic efficacy and safety of recombinant human interferon gel combined with Baofukang suppository in the treatment of cervical high-risk human papillomavirus (HPV)infection. METHODS :Totally 259 patients with persistent high-risk HPV infection diagnosed and treated in gynecology department of the First Affiliated Hospital of Hainan Medical University from Aug. 2017 to Sept. 2019 were selected and divided into interferon group (n=82),Baofukang suppository group (n=86)and combination group (n=91)according to random number table. The patients in interferon group and Baofukang suppository group were given Recombinant human interferon α2b gel 1 g, qd or Baofukang suppository 1 capsule,qd; the patients in combination group were given Recombinant human interferon α2b gel and Baofukang suppository 1 capsule,qd;for 3 months. Then the clinical efficacy ,negative time of HPV ,duration of abnormal secretion ,LCT test results ,cervical inflammation score ,HPV relative light unit/critical value (RLU/CO)and the incidence of ADR were recorded. RESULTS :The total effective rate of combination group was significantly higher than that of interferon group and Baofukang suppository group , the negative time of HPV and duration of abnormal secretion in combination group were significantly shorter than interferon group and Baofukang suppository group (P<0.05). Before treatment ,the normal rate of LCT of 3 groups were 0,and there was no statistical significance in cervical inflammation score and HPV RLU/CO among 3 groups(P>0.05). After treatment ,normal rate of LCT was increased in 3 groups,compared with before treatment (P<0.05),and normal rate of LCT in combination group was significantly higher than interferon group and Baofukang suppository group. The cervical inflammation score and HPV RLU/CO were significantly lower than before treatment ,and the combination group was significantly lower than interferon group and Baofukang suppository group (P<0.05). There was no statistical significance in above indicatora after treatment betwent interferon group and Baofukang suppository group and the incidence of ADR among 3 groups during medication (P>0.05). CONCLUSIONS:The application of recombinant human interferon gel combined with Baofukang suppository is effective and safe way in the treatment of cervical high-risk HPV infection.
10.Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients (version 2024)
Yao LU ; Yang LI ; Leiying ZHANG ; Hao TANG ; Huidan JING ; Yaoli WANG ; Xiangzhi JIA ; Li BA ; Maohong BIAN ; Dan CAI ; Hui CAI ; Xiaohong CAI ; Zhanshan ZHA ; Bingyu CHEN ; Daqing CHEN ; Feng CHEN ; Guoan CHEN ; Haiming CHEN ; Jing CHEN ; Min CHEN ; Qing CHEN ; Shu CHEN ; Xi CHEN ; Jinfeng CHENG ; Xiaoling CHU ; Hongwang CUI ; Xin CUI ; Zhen DA ; Ying DAI ; Surong DENG ; Weiqun DONG ; Weimin FAN ; Ke FENG ; Danhui FU ; Yongshui FU ; Qi FU ; Xuemei FU ; Jia GAN ; Xinyu GAN ; Wei GAO ; Huaizheng GONG ; Rong GUI ; Geng GUO ; Ning HAN ; Yiwen HAO ; Wubing HE ; Qiang HONG ; Ruiqin HOU ; Wei HOU ; Jie HU ; Peiyang HU ; Xi HU ; Xiaoyu HU ; Guangbin HUANG ; Jie HUANG ; Xiangyan HUANG ; Yuanshuai HUANG ; Shouyong HUN ; Xuebing JIANG ; Ping JIN ; Dong LAI ; Aiping LE ; Hongmei LI ; Bijuan LI ; Cuiying LI ; Daihong LI ; Haihong LI ; He LI ; Hui LI ; Jianping LI ; Ning LI ; Xiying LI ; Xiangmin LI ; Xiaofei LI ; Xiaojuan LI ; Zhiqiang LI ; Zhongjun LI ; Zunyan LI ; Huaqin LIANG ; Xiaohua LIANG ; Dongfa LIAO ; Qun LIAO ; Yan LIAO ; Jiajin LIN ; Chunxia LIU ; Fenghua LIU ; Peixian LIU ; Tiemei LIU ; Xiaoxin LIU ; Zhiwei LIU ; Zhongdi LIU ; Hua LU ; Jianfeng LUAN ; Jianjun LUO ; Qun LUO ; Dingfeng LYU ; Qi LYU ; Xianping LYU ; Aijun MA ; Liqiang MA ; Shuxuan MA ; Xainjun MA ; Xiaogang MA ; Xiaoli MA ; Guoqing MAO ; Shijie MU ; Shaolin NIE ; Shujuan OUYANG ; Xilin OUYANG ; Chunqiu PAN ; Jian PAN ; Xiaohua PAN ; Lei PENG ; Tao PENG ; Baohua QIAN ; Shu QIAO ; Li QIN ; Ying REN ; Zhaoqi REN ; Ruiming RONG ; Changshan SU ; Mingwei SUN ; Wenwu SUN ; Zhenwei SUN ; Haiping TANG ; Xiaofeng TANG ; Changjiu TANG ; Cuihua TAO ; Zhibin TIAN ; Juan WANG ; Baoyan WANG ; Chunyan WANG ; Gefei WANG ; Haiyan WANG ; Hongjie WANG ; Peng WANG ; Pengli WANG ; Qiushi WANG ; Xiaoning WANG ; Xinhua WANG ; Xuefeng WANG ; Yong WANG ; Yongjun WANG ; Yuanjie WANG ; Zhihua WANG ; Shaojun WEI ; Yaming WEI ; Jianbo WEN ; Jun WEN ; Jiang WU ; Jufeng WU ; Aijun XIA ; Fei XIA ; Rong XIA ; Jue XIE ; Yanchao XING ; Yan XIONG ; Feng XU ; Yongzhu XU ; Yongan XU ; Yonghe YAN ; Beizhan YAN ; Jiang YANG ; Jiangcun YANG ; Jun YANG ; Xinwen YANG ; Yongyi YANG ; Chunyan YAO ; Mingliang YE ; Changlin YIN ; Ming YIN ; Wen YIN ; Lianling YU ; Shuhong YU ; Zebo YU ; Yigang YU ; Anyong YU ; Hong YUAN ; Yi YUAN ; Chan ZHANG ; Jinjun ZHANG ; Jun ZHANG ; Kai ZHANG ; Leibing ZHANG ; Quan ZHANG ; Rongjiang ZHANG ; Sanming ZHANG ; Shengji ZHANG ; Shuo ZHANG ; Wei ZHANG ; Weidong ZHANG ; Xi ZHANG ; Xingwen ZHANG ; Guixi ZHANG ; Xiaojun ZHANG ; Guoqing ZHAO ; Jianpeng ZHAO ; Shuming ZHAO ; Beibei ZHENG ; Shangen ZHENG ; Huayou ZHOU ; Jicheng ZHOU ; Lihong ZHOU ; Mou ZHOU ; Xiaoyu ZHOU ; Xuelian ZHOU ; Yuan ZHOU ; Zheng ZHOU ; Zuhuang ZHOU ; Haiyan ZHU ; Peiyuan ZHU ; Changju ZHU ; Lili ZHU ; Zhengguo WANG ; Jianxin JIANG ; Deqing WANG ; Jiongcai LAN ; Quanli WANG ; Yang YU ; Lianyang ZHANG ; Aiqing WEN
Chinese Journal of Trauma 2024;40(10):865-881
Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.