1.Small interfering RNA delivery mediated by mPEG-PCL-g-PEI polymer nanoparticles.
Wei HUANG ; Ming Lü ; Zhonggao GAO ; Mingji JIN ; Changqing YANG
Acta Pharmaceutica Sinica 2011;46(3):344-9
The aim of this paper is to report the synthesis of the mPEG-PCL-g-PEI copolymers as small interfering RNA (siRNA) delivery vector, and exploration of the siRNA delivery potential of mPEG-PCL-g-PEI in vitro. The diblock copolymers mPEG-PCL-OH was prepared through the ring-opening polymerization. Then, the hydroxyl terminal (-OH) of mPEG-PCL-OH was chemically converted into the carboxy (-COOH) and N-hydroxysuccinimide (NHS) in turn to prepare mPEG-PCL-NHS. The branched PEI was reacted with mPEG-PCL-NHS to synthesize the ternary copolymers mPEG-PCL-g-PEI. The structure of mPEG-PCL-g-PEI copolymers was characterized with Fourier transform infrared spectroscopy (FTIR), nuclear magnetic resonance (NMR) and gel permeation chromatography (GPC). The mPEG-PCL-g-PEI/siRNA nanoparticles were prepared by complex coacervation, and the nanoparticles size and zeta potential were determined, separately. The cytotoxicities of mPEG-PCL-g-PEI/siRNA nanoparticles and PEI/siRNA nanoparticles were compared through cells MTT assays in vitro. The inhibition efficiencies of firefly luciferase gene expression by mPEG-PCL-g-PEI/ siRNA nanoparticle at various N/P ratios were investigated through cell transfection in vitro. The experimental results suggested that the ternary (mPEG5k-PCL(1.2k))1.4-g-PEI(10k) copolymers were successfully synthesized. (mPEG(5k)-PCL(1.2k))1.4-g-PEI(10k) could condense siRNA into nanoparticles (50-200 nm) with positive zeta potential. MTT assay results showed that the cytotoxicity of (mPEG(5k)-PCL(1.2k))1.4-g-PEI(10k)/siRNA nanoparticles was significantly lower than that of PEI(10k)/siRNA nanoparticles (P < 0.05). The expression of firefly luciferase gene could be significantly down-regulated at a range of N/P ratio from 50 to 150 (P < 0.01), and maximally inhibited at the N/P ratio of 125. The mPEG-PCL-g-PEI polymers could delivery siRNA into cells to inhibit the expression of target gene with very low cytotoxicity, which suggested that mPEG-PCL-g-PEI could serve as a new type of siRNA delivery vector.
2.Small interfering RNA delivery mediated by mPEG-PCL-g-PEI polymer nanoparticles.
Wei HUANG ; Ming LÜ ; Zhong-Gao GAO ; Ming-Ji JIN ; Chang-Qing YANG
Acta Pharmaceutica Sinica 2011;46(3):344-349
The aim of this paper is to report the synthesis of the mPEG-PCL-g-PEI copolymers as small interfering RNA (siRNA) delivery vector, and exploration of the siRNA delivery potential of mPEG-PCL-g-PEI in vitro. The diblock copolymers mPEG-PCL-OH was prepared through the ring-opening polymerization. Then, the hydroxyl terminal (-OH) of mPEG-PCL-OH was chemically converted into the carboxy (-COOH) and N-hydroxysuccinimide (NHS) in turn to prepare mPEG-PCL-NHS. The branched PEI was reacted with mPEG-PCL-NHS to synthesize the ternary copolymers mPEG-PCL-g-PEI. The structure of mPEG-PCL-g-PEI copolymers was characterized with Fourier transform infrared spectroscopy (FTIR), nuclear magnetic resonance (NMR) and gel permeation chromatography (GPC). The mPEG-PCL-g-PEI/siRNA nanoparticles were prepared by complex coacervation, and the nanoparticles size and zeta potential were determined, separately. The cytotoxicities of mPEG-PCL-g-PEI/siRNA nanoparticles and PEI/siRNA nanoparticles were compared through cells MTT assays in vitro. The inhibition efficiencies of firefly luciferase gene expression by mPEG-PCL-g-PEI/ siRNA nanoparticle at various N/P ratios were investigated through cell transfection in vitro. The experimental results suggested that the ternary (mPEG5k-PCL(1.2k))1.4-g-PEI(10k) copolymers were successfully synthesized. (mPEG(5k)-PCL(1.2k))1.4-g-PEI(10k) could condense siRNA into nanoparticles (50-200 nm) with positive zeta potential. MTT assay results showed that the cytotoxicity of (mPEG(5k)-PCL(1.2k))1.4-g-PEI(10k)/siRNA nanoparticles was significantly lower than that of PEI(10k)/siRNA nanoparticles (P < 0.05). The expression of firefly luciferase gene could be significantly down-regulated at a range of N/P ratio from 50 to 150 (P < 0.01), and maximally inhibited at the N/P ratio of 125. The mPEG-PCL-g-PEI polymers could delivery siRNA into cells to inhibit the expression of target gene with very low cytotoxicity, which suggested that mPEG-PCL-g-PEI could serve as a new type of siRNA delivery vector.
Cell Line, Tumor
;
Cell Survival
;
Drug Carriers
;
Genes, Reporter
;
Genetic Vectors
;
Humans
;
Luciferases
;
metabolism
;
Molecular Weight
;
Nanoparticles
;
Particle Size
;
Polyesters
;
chemistry
;
Polyethylene Glycols
;
chemistry
;
Polyethyleneimine
;
chemistry
;
Polymers
;
chemistry
;
RNA, Small Interfering
;
administration & dosage
;
genetics
;
metabolism
;
Transfection
3.Surgical treatment of recurrent laryngeal nerve injury caused by thyroid operation.
Xin-sheng LÜ ; Xin-ying LI ; Zhi-ming WANG ; Le-du ZHOU ; Jin-dong LI
Chinese Journal of Surgery 2005;43(5):301-303
OBJECTIVETo study the surgical treatment of recurrent laryngeal nerve (RLN) injury caused by thyroid operation.
METHODSFrom 1970 to 2001, 50 patients with RLN injury were caused by thyroid operation. The causes, location, type, operative procedures and follow-up were retrospectively analyzed.
RESULTSUnilateral RLN injury occurred in 46 cases and bilateral nerve injury in 4 cases. The RLN injuries were located within 2cm below the point of RLN entering to throat in 45 nerves (83.3%), other places in 6 nerves (11.3%), and unknown location in 3 nerves (5.4%). Transection of the nerve was found in 19 nerves (36.5%), suture or scare pressing the nerve in 35 nerves (64.8%). All the injured nerves were repaired surgically. Meanwhile all 4 patients with bilateral RLN injuries underwent tracheotomy. Of the 50 cases, 44 cases (88.0%) were followed up for more than 1.5 years. Among the 44 followed-up patients, phonation was restored to normal or obvious improvement in 42 cases (95.5%), and improvement in 2 (4.5%). Of the 35 patients with 39 nerves underwent indirect or direct laryngoscopy, the affected vocal cord movement entirely recovered in 21 cords (53.8%), partially recovered in 7 cords (17.9%), uncovered in 11 cords (28.3%). There was no relation between the recovery of phonation or vocal cord movement with the timing or the procedure of repairing operation.
CONCLUSIONSThe location of most RLN injuries caused by thyroid surgery are just below the point of RLN entering to throat, and most are mechanical injury, and need operation to resolve the cause. Once the RLN injury is made, an operation should be performed as early as possible.
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Recurrent Laryngeal Nerve Injuries ; Retrospective Studies ; Thyroidectomy ; adverse effects ; Treatment Outcome ; Vocal Cord Paralysis ; etiology ; surgery
4.Spontaneous remission of acromegaly or gigantism due to subclinical apoplexy of pituitary growth hormone adenoma.
Xian-Ling WANG ; Jing-Tao DOU ; Zhao-Hui LÜ ; Wen-Wen ZHONG ; Jian-Ming BA ; Du JIN ; Ju-Ming LU ; Chang-Yu PAN ; Yi-Ming MU
Chinese Medical Journal 2011;124(22):3820-3823
BACKGROUNDSubclinical apoplexy of pituitary functional adenoma can cause spontaneous remission of hormone hypersecretion. The typical presence of pituitary growth hormone (GH) adenoma is gigantism and/or acromegaly. We investigated the clinical characteristics of patients with spontaneous partial remission of acromegaly or gigantism due to subclinical apoplexy of GH adenoma.
METHODSSix patients with spontaneous remission of acromegaly or gigantism were enrolled. The clinical characteristics, endocrinological evaluation and imageological characteristics were retrospectively analyzed.
RESULTSIn these cases, the initial clinical presences were diabetes mellitus or hypogonadism. No abrupt headache, vomiting, visual function impairment, or conscious disturbance had ever been complained of. The base levels of GH and insulin growth factor-1 (IGF-1) were normal or higher, but nadir GH levels were all still > 1 µg/L in 75 g oral glucose tolerance test. Magnetic resonance imaging detected enlarged sella, partial empty sella and compressed pituitary. The transsphenoidal surgery was performed in 2 cases, and the other patients were conservatively managed. All the patients were in clinical remission.
CONCLUSIONSWhen the clinical presences, endocrine evaluation, biochemical examination and imageology indicate spontaneous remission of GH hypersecretion in patients with gigantism or acromegaly, the diagnosis of subclinical apoplexy of pituitary GH adenoma should be presumed. To these patients, conservative therapy may be appropriate.
Acromegaly ; diagnosis ; etiology ; Adolescent ; Adult ; Aged ; Female ; Gigantism ; diagnosis ; etiology ; Growth Hormone-Secreting Pituitary Adenoma ; complications ; Humans ; Immunohistochemistry ; Magnetic Resonance Imaging ; Male ; Middle Aged ; Pituitary Neoplasms ; complications ; Young Adult
5.Management status of type 2 diabetes mellitus in tertiary hospitals in Beijing: gap between guideline and reality.
Ming-Zi LI ; Li-Nong JI ; Zhao-Lin MENG ; Xiao-Hui GUO ; Jin-Kui YANG ; Ju-Ming LU ; Xiao-Feng LÜ ; Xu HONG
Chinese Medical Journal 2012;125(23):4185-4189
BACKGROUNDDiabetes has become one of the most common chronic diseases and the third leading cause of death in China. Many programs have been initiated at national and local levels to address the illness. However, the effect of these programs in daily outpatient clinics is still unclear. The objective of this study was to investigate the management status of type 2 diabetes mellitus (T2DM) and factors associated with it in diabetes clinics of tertiary hospitals in Beijing.
METHODSA cross-sectional survey was conducted in six tertiary hospitals in Beijing. Control criteria were defined based on 2007 China guideline for type 2 diabetes (CGT2D).
RESULTSA sample of 1151 patients, age (60.8 ± 9.2) years, and with a median disease duration of 7.3 years was included. The hemoglobin A1c (HbA1c) mean level was (7.15 ± 1.50)%, the percentage of patients achieving the targets for HbA1c was 37.8%, blood pressure 65.6%, triglyceride (TG) 48.8%, high-density lipoprotein (HDL) 59.2%, low-density lipoprotein (LDL) 34.0%, and total cholesterol (TC) 42.0%. The factors independently associated with glycemic control were diabetes duration (odds ratio (OR) = 0.95; 95% confidence interval (CI): 0.919 - 0.982, P < 0.01), body mass index (BMI) (OR = 0.914, 95%CI: 0.854 - 0.979, P = 0.01) and smoking (OR = 0.391, 95%CI: 0.197 - 0.778, P < 0.01). The factors independently associated with blood pressure control were BMI (OR = 0.915, 95%CI: 0.872 - 0.960, P < 0.01) and male gender (OR = 0.624, 95%CI: 0.457 - 0.852, P < 0.01). The factor independently associated with LDL control was education level (OR = 1.429, 95%CI: 1.078 - 1.896, P = 0.013).
CONCLUSIONSThe management status of T2DM patients in tertiary hospitals in Beijing has improved remarkably. However, there is still room for further improvement to reach the guideline target. Long diabetes duration, high BMI, smoking, male gender and low education level were independently associated with poor metabolic control.
Adolescent ; Adult ; Aged ; Blood Glucose ; metabolism ; Blood Pressure ; China ; Cholesterol ; blood ; Diabetes Mellitus, Type 2 ; blood ; metabolism ; Female ; Glycated Hemoglobin A ; metabolism ; Hospitals ; statistics & numerical data ; Humans ; Lipoproteins, HDL ; blood ; Lipoproteins, LDL ; blood ; Male ; Middle Aged ; Triglycerides ; blood ; Young Adult
6.P70S6K is involved in the inhibition of testosterone production in TM3 mouse Leydig cells overexpressing Cox7a2.
Liang CHEN ; Jin-Ming JIA ; Wei ZHONG ; Yan-Lei ZHANG ; Jian LÜ ; Hong-Wu WANG ; Zheng ZHOU ; Ming-Xiao WANG ; Zhong-Cheng XIN ; Ying-Lu GUO
National Journal of Andrology 2011;17(4):291-295
OBJECTIVETo investigate the effects of Cox7a2 on the LH-induced testosterone production and the involved autophagy regulating signals in TM3 mouse Leydig cells.
METHODSThe Cox7a2-pEYFP-N1 fluorescent protein vector was constructed and transfected into TM3 mouse Leydig cells. The level of testosterone was determined by ELISA, and the effects of Cox7a2 on the expression of the steroidogenic acute regulatory protein (StAR) and the phosphorylation of the autophagy regulatory factor P70S6K were detected by Western blot.
RESULTSLH stimulation increased the StAR protein expression and testosterone production, while Cox7a2 decreased P70S6K phosphorylation, reduced StAR expression and consequently inhibited LH-induced testosterone biosynthesis in the TM3 Leydig cells.
CONCLUSIONCox7a2 inhibits testosterone production by decreasing the StAR protein expression, which might be at least in part related with the activation of autophagy in TM3 mouse Leydig cells.
Animals ; Autophagy ; Cells, Cultured ; Electron Transport Complex IV ; genetics ; Leydig Cells ; metabolism ; Luteinizing Hormone ; pharmacology ; Male ; Mice ; Phosphoproteins ; metabolism ; Phosphorylation ; Ribosomal Protein S6 Kinases, 70-kDa ; metabolism ; Testosterone ; biosynthesis
7.Tree analysis pattern of mass spectral urine profiles in differential diagnosis of bladder transitional cell carcinoma.
Deng-long WU ; Yuan-fang ZHANG ; Ming GUAN ; Wei-wei LIU ; Yue-min XU ; San-bao JIN ; Jiong ZHANG ; Chong-rui JIN ; Yuan LÜ
Chinese Journal of Oncology 2007;29(4):274-277
OBJECTIVETo develope a tree analysis pattern of mass spectral urine profiles to discriminate bladder transitional cell carcinoma (TCC) from non-cancer lesions using surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF-MS) technology.
METHODSUrine samples from 61 bladder transitional cell carcinoma (TCCs) patients, 53 healthy volunteers and 42 patients with other urogenital diseases were analyzed using IMAC-Cu-3 ProteinChip. Proteomic spectra were generated by SELDI-TOF- MS. A preliminary "training" set of spectra derived from analysis of urine from 46 TCC patients, 32 patients with benign urogenital diseases (BUD), and 40 age-matched unaffected healthy men were used to train and develop a decision tree classification algorithm which identified a fine-protein mass pattern that discriminated cancers from non-cancers effectively. A blinded test set including 38 cases was used to determine the sensitivity and specificity of the classification system.
RESULTSThe algorithm identified a cluster pattern that, in the training set, segregated cancer from non-cancer with a sensitivity of 84.8% and specificity of 91.7%. The discriminatory pattern was correctly identified. A sensitivity of 93.3% and a specificity of 87% for the blinded test were obtained when compared the TCC versus non-cancers.
CONCLUSIONSELDI-TOF-MS technology is a rapid, convenient and high-throughput analyzing method. The urine tree analysis proteomic pattern as a screening tool is effective for differential diagnosis of bladder cancer. More detailed studies are needed to further evaluate the clinical value of this pattern.
Adult ; Aged ; Aged, 80 and over ; Carcinoma, Transitional Cell ; diagnosis ; urine ; Cystitis ; diagnosis ; urine ; Decision Trees ; Diagnosis, Differential ; Humans ; Male ; Middle Aged ; Prostatic Hyperplasia ; diagnosis ; urine ; Protein Array Analysis ; Proteomics ; methods ; Reproducibility of Results ; Sensitivity and Specificity ; Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization ; methods ; Urinary Bladder Neoplasms ; diagnosis ; urine
8.The observe of clinical effect of treating lumbar intervertebral disc herniation by bone setting manipulation of different directions.
Li-jiang LÜ ; Ye-dao JIN ; Ru-yun ZHENG ; Bing-hua FAN ; Mi-xiong YANG ; Xiao-ming YING ; Qi-Kai WANG ; Wen-bo ZHANG
China Journal of Orthopaedics and Traumatology 2009;22(4):255-258
OBJECTIVETo compare the effect between lumbar backwards flexion manipulation and rotating manipulation for treating lumbar intervertebral disc herniation.
METHODSTwo hundred and nine patients of lumbar intervertebral disc herniation, male 131, female 78, the age from 20 to 79 years old, 58 cases of all these patients age above 50. According to diagnosis the ladder of the 92 cases bulging type, 69 hernia type, 48 cases free type. The patients were randomly divided into treatment group (107 cases) and control group (102 cases). All the patients were treated with the three-dimensional computer-controlled traction therapeutic apparatus, with continued traction for 30 minutes. After traction, lumbar backwards flexion manipulation and rotating manipulation were respectively adopted in treatment group and control group (on alternate days one time, 3 times as a course of treatment). The symptoms and signs (including back pain and discomfort, lower limb pain and numbness, powerless urination and defecation, numbness in perineum, straight-leg raising degree, ability of lower extremity walking, work and live) of patients were observed after treatment.
RESULTSAll the patients were followed up from 1 to 6 months with an average of 3.2 months. After treatment, the symptoms and signs of patients have markedly improved (P < 0.01), but the lower back pain and discomfort, lower limb walking ability in treatment group were better than control group (P < 0.05). According therapeutic criteria, the effect of treatment group was better than of control group (P < 0.01). In cases with bulging type, 47 in treatment group and 45 in control group, the effect of treatment group was better than of control group (P < 0.05); in cases with hernia type, 35 in treatment group and 34 in control group, there was no significantly difference in effect between two groups (P > 0.05); in cases of free type, 25 in treatment group and 23 in control group, there was no significantly difference in effect between two groups (P > 0.05).
CONCLUSIONThe global effect of lumbar backwards flexion manipulation was satisfactory than rotating manipulation for treating lumbar intervertebral disc herniation. But rotating manipulation suited to free type.
Adult ; Aged ; Female ; Follow-Up Studies ; Humans ; Intervertebral Disc Displacement ; surgery ; therapy ; Lumbar Vertebrae ; pathology ; Male ; Manipulation, Orthopedic ; methods ; Middle Aged ; Treatment Outcome
9.Study on the prevalence rate of chronic obstructive pulmonary disease in northern part of Guangdong province.
Xiao-ping WANG ; Yu-min ZHOU ; Xiang-yi ZENG ; Sheng-ming LIU ; Rong QIU ; Jun-fen XIE ; Jin-ping ZHENG ; Jia-chun LÜ ; Nan-shan ZHONG ; Pi-xin RAN
Chinese Journal of Epidemiology 2005;26(3):211-213
OBJECTIVETo investigate the prevalence of chronic obstructive pulmonary disease (COPD) and its risk factors in population over 40 years old in northern part of Guangdong province.
METHODSUsing uniform scheme, procedures and questionnaire, a cluster-randomized-sampling survey for the population aged over 40 years in a rural area of Shaoguan in the northern part of Guangdong province was performed. Spirometry was performed for every participant, followed by a bronchodilatation test when bronchial obstruction was present.
RESULTSThere were 1468 cases with complete data from 1498 people aged >or= 40 years including 640 males, 828 females with an average age of 54.3 years old. The total prevalence of COPD was 12.0%. The prevalence of COPD in males was significantly higher than that in females (18.3% vs. 7.1%, P < 0.01). Only 80.7% of the patients with COPD presented one or more symptoms as cough, phlegm, or dyspnoea. Underdiagnosis of COPD would be quite serious. Only 26.1% of the cases was previously diagnosed to have chronic bronchitis, emphysema, or COPD. Smoking was an important risk factor to COPD and 78.4% of the patients with COPD were smokers. However, relation of biomass and COPD called for further investigation.
CONCLUSIONPrevalence of COPD was much higher than expected in the northern part of Guangdong while smoking was an most important risk factor of COPD. Lung function test seemed to be of great importance to COPD diagnosis, especially in the earlier period of COPD.
Adult ; China ; epidemiology ; Female ; Humans ; Male ; Mass Screening ; Middle Aged ; Prevalence ; Pulmonary Disease, Chronic Obstructive ; epidemiology ; Risk Factors ; Sex Factors ; Smoking ; adverse effects ; Surveys and Questionnaires
10.Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus.
Yan-Yu ZHANG ; Ping MA ; Yi-Ming LU ; Li-Ping LÜ ; Sheng-Yang JIANG ; Xi-Peng ZHOU ; Shu-Han SUN ; Jin-Bo XU
Journal of Experimental Hematology 2005;13(4):542-547
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.
Agkistrodon
;
genetics
;
Amino Acid Sequence
;
Animals
;
Base Sequence
;
Cloning, Molecular
;
Crotalid Venoms
;
biosynthesis
;
enzymology
;
genetics
;
DNA, Complementary
;
chemistry
;
genetics
;
Escherichia coli
;
genetics
;
Metalloendopeptidases
;
biosynthesis
;
genetics
;
Molecular Sequence Data
;
Recombinant Proteins
;
biosynthesis
;
Reverse Transcriptase Polymerase Chain Reaction
;
Sequence Analysis, DNA
;
Sequence Homology, Nucleic Acid
;
Thrombin
;
biosynthesis
;
genetics