ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To explore a model for constructing a platform for medical institution formulation and provide insights for promoting their development. METHODS By systematically reviewing the development status and challenges of medical institution preparations in China， and based on the theory of industry-university-research collaborative innovation， the organizational structure， collaborative processes， and safeguard mechanisms of the platform were designed. RESULTS & CONCLUSIONS Medical institution formulations in China mainly faced challenges such as weak research and development （R&D） capacity， uneven quality standards， and blocked transformation pathways. This study established a full-chain， whole- industry collaborative innovation network covering the government， medical institutions， universities/research institutes， pharmaceutical enterprises， and the market， forming a new “government-industry-university-research-application” five-in-one platform model for medical institution formulations. By establishing mechanisms such as multi-entity collaborative cooperation， full- chain intellectual property management， contribution-based benefit distribution， staged risk-sharing， and third-party evaluation， the model clarified the responsibilities and collaborative pathways of all parties. The new model highlights the whole-process transformation of clinical experience-based prescriptions， enabling precise alignment between clinical needs and technological R&D， as well as between preparation achievements and industrial transformation. While breaking down the barriers of traditional platform construction， it effectively achieves optimal resource allocation and complementary advantages， addresses problems emerging in the development of medical institution preparations， and provides reference value for the formulation of relevant systems.

Oral squamous cell carcinoma (OSCC) is a common head and neck malignancy. Approximately 50% to 60% of patients with OSCC are diagnosed at a locally advanced stage (clinical staging III-IVa). Even with comprehensive and sequential treatment primarily based on surgery, the 5-year overall survival rate remains below 50%, and patients often suffer from postoperative functional impairments such as difficulties with speaking and swallowing. Programmed death receptor-1 (PD-1) inhibitors are increasingly used in the neoadjuvant treatment of locally advanced OSCC and have shown encouraging efficacy. However, clinical practice still faces key challenges, including the definition of indications, optimization of combination regimens, and standards for efficacy evaluation. Based on the latest research advances worldwide and the clinical experience of the expert group, this expert consensus systematically evaluates the application of PD-1 inhibitors in the neoadjuvant treatment of locally advanced OSCC, covering combination strategies, treatment cycles and surgical timing, efficacy assessment, use of biomarkers, management of special populations and immune related adverse events, principles for immunotherapy rechallenge, and function preservation strategies. After multiple rounds of panel discussion and through anonymous voting using the Delphi method, the following consensus statements have been formulated: 1) Neoadjuvant therapy with PD-1 inhibitors can be used preoperatively in patients with locally advanced OSCC. The preferred regimen is a PD-1 inhibitor combined with platinum based chemotherapy, administered for 2-3 cycles. 2) During the efficacy evaluation of neoadjuvant therapy, radiographic assessment should follow the dual criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 and immune RECIST (iRECIST). After surgery, systematic pathological evaluation of both the primary lesion and regional lymph nodes is required. For combination chemotherapy regimens, PD-L1 expression and combined positive score need not be used as mandatory inclusion or exclusion criteria. 3) For special populations such as the elderly (≥ 70 years), individuals with stable HIV viral load, and carriers of chronic HBV/HCV, PD-1 inhibitors may be used cautiously under the guidance of a multidisciplinary team (MDT), with close monitoring for adverse events. 4) For patients with a poor response to neoadjuvant therapy, continuation of the original treatment regimen is not recommended; the subsequent treatment plan should be adjusted promptly after MDT assessment. Organ transplant recipients and patients with active autoimmune diseases are not recommended to receive neoadjuvant PD-1 inhibitor therapy due to the high risk of immune related activation. Rechallenge is generally not advised for patients who have experienced high risk immune related adverse events such as immune mediated myocarditis, neurotoxicity, or pneumonitis. 5) For patients with a good pathological response, individualized de escalation surgery and function preservation strategies can be explored. This consensus aims to promote the standardized, safe, and precise application of neoadjuvant PD-1 inhibitor strategies in the management of locally advanced OSCC patients.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

ObjectiveTo study the pharmacological substances and mechanisms through which sesquiterpene ZH-13 from Aquilariae Lignum Resinatum improves neuroinflammation. MethodsBV-2 microglial cells were stimulated with lipopolysaccharide （LPS） to induce neuroinflammation. The cells were divided into the normal group， the model group， and the ZH-13 low- and high-dose treatment groups （10， 20 μmol·L^-1）. The model group was treated with 1 μmol·L^-1 LPS. Cell viability was assessed using the cell proliferation and activity assay （CCK-8 kit）. Nitric oxide （NO） release in the cell supernatant was measured using a nitric oxide kit （Griess method）. The mRNA expression levels of interleukin-1β （IL-1β）， tumor necrosis factor-α （TNF-α）， inducible nitric oxide synthase （iNOS）， and interleukin-6 （IL-6） were detected by real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. The phosphorylation of mitogen-activated protein kinase （MAPK） pathway proteins was assessed by Western blot. ResultsCompared with the model group， ZH-13 dose-dependently reduced NO release from BV-2 cells under LPS stimulation （P<0.05， P<0.01）. In the 20 μmol·L^-1 ZH-13 treatment group， the mRNA expression levels of IL-1β， TNF-α， iNOS， and IL-6 were significantly reduced compared to the model group （P<0.05， P<0.01）. In both the low- and high-dose ZH-13 groups， the expression of the inflammatory factor TNF-α and the phosphorylation of c-Jun N-terminal kinase （JNK） in the upstream MAPK pathway were significantly reduced （P<0.05）. After stimulation with the JNK agonist anisomycin （Ani）， both low- and high-dose ZH-13 treatment groups showed reduced phosphorylation of JNK proteins compared to the Ani-treated group （P<0.01）. ConclusionThe sesquiterpene compound ZH-13 from Aquilariae Lignum Resinatum significantly ameliorates LPS-induced neuroinflammatory responses in BV-2 cells by inhibiting excessive JNK phosphorylation and reducing TNF-α expression. These findings elucidate the pharmacological substances and mechanisms underlying the sedative and calming effects of Aquilariae Lignum Resinatum.

Diabetic macular edema(DME), a serious complication of diabetic retinopathy(DR), is a chronic condition caused by multiple factors. Throughout its progression, inflammatory factors and vascular endothelial growth factor(VEGF)play a critical role. Anti-VEGF drugs have shown significant effectiveness in the treatment of DME; however, some patients may experience persistent DME after injection or require frequent injections. Dexamethasone intravitreal implants(DEX implants)serve as a sustained-release implant characterized by a reasonable release profile and high bioavailability. They offer safe, effective, and prolonged anti-inflammatory effects, aiding in the repair of retinal barrier and reduction of exudation. To further enhance patients' visual quality, exploring the efficacy of DEX implants in combination with existing treatment regimens has great clinical significance. This review primarily discusses the research advancements in DEX implants, focusing on their pharmacological properties, indications for use, and their combination with existing drugs and treatment methods. It also evaluates the advantages and disadvantages of combination therapy or switching to DEX implants compared to current standard treatments, aiming to provide guidance for personalized treatment options for patients with DME.

Objective To analyze the adverse reaction reports （ADRs） of drug-induced liver injury in recent ten years, explore the characteristics and related rules of drug-induced liver injury, and provide reference for clinical safe drug use. Methods ADRs in our hospital from 2011 to 2021 which belonged to drug-induced liver injuries were collected, and Pareto analysis was carried on. Results In 259 ADR reports, the most common type of drug-induced liver injury was hepatocellular injury （37.84%）. The age of drug-induced liver injury was mainly over 46 years, totaling 195 （75.28%）. Drugs were mainly distributed in cardiovascular system medicine （44.02%）, anti-infective medicine （23.94%）and anti-tumor medicine （11.58%）. Among the cardiovascular drugs, atorvastatin calcium 40mg and over 40mg were the highest proportion, with 53 cases （46.49%）. The main anti-infectious drugs were cephalosporins （29.03%）, carbapenem （19.35%）， antifungal （17.74%）and quinolones （11.29%）. Adverse reactions occurred within 6 days （69.88%）, the duration of adverse reactions was 1-2 weeks （31.66%）, and most patients were improved （47.88%） or cured （37.07%）. Conclusion For middle-aged and elderly patients, when the application of cardiovascular system drugs, anti-infective drugs or anti-tumor drugs, it is necessary to monitor the liver function changes of patients for at least 6 days. If there are abnormalities, the drugs should be stopped or given treatment in time, to avoid the progress of drug-induced liver injury.

OBJECTIVE To provide reference for improving the pre-prescription review system and reducing the occurrence of medication error by analyzing the drug-related problems （DRPs） in the pre-prescription review orders of pediatric outpatient clinics using the Pharmaceutical Care Network Europe （PCNE） classification system. METHODS The data of pre-prescription review orders were retrospectively collected from outpatient department of Shanghai Children’s Medical Center， Shanghai Jiao Tong University School of Medicine from July 2022 to June 2023； DRPs in the pre-prescription review orders were classified and summarized by using the PCNE classification system （version 9.1）， and then analyzed in terms of types and causes of issues， and the acceptance of interventions. RESULTS A total of 66 017 DRPs orders were included， involving 41 165 patients. The proportion of DRPs orders in children aged ≤5 years old was the highest （58.25%）， followed by children aged 6-12 years old （33.52%）； the department with the highest proportion of DRPs was internal medicine of pediatrics department （71.41%）； the department with the highest incidence of DRPs was thoracic surgery department （9.73%）； top three drug categories of DRPs orders were systemic anti- infective drugs （25.26%）， Chinese patent medicines （24.74%） and respiratory drugs （22.38%）. Referring to PCNE classification system， the types of DRPs mainly focused on treatment safety （64.86%）； the reasons of DRPs orders mainly focused on dose selection （82.09%）， of which 41.26% were due to excessive drug dosage； 92.13% of interventions could be accepted and fully executed by doctors. CONCLUSIONS DRPs orders identified by the pre-prescription review system can be effectively analyzed by using PCNE classification system. Pharmacists should focus on medication use in children aged ≤5 years old， update and develop personalized prescription review rules timely， and meet the rational needs of clinical medication for children.

ObjectiveTo investigate the efficacy of Xingpi capsules （XPC） in treating diarrhea-predominant irritable bowel syndrome （IBS-D） with spleen deficiency and elucidate its potential molecular mechanisms. MethodsA rat model of IBS-D with spleen deficiency was established by administering senna leaf in combination with restrained stress and swimming fatigue for 14 d. Ten specific pathogen free （SPF）-grade healthy rats were used as the normal control group. After successful modeling， SPF-grade rats were randomly divided into a model group， a pinaverium bromide group （1.5 mg·kg^-1）， and low- and high-dose XPC groups （0.135 and 0.54 g·kg^-1）， with 10 rats in each group. Rats in the normal control group and the model group were given distilled water by gavage， while the remaining groups were administered corresponding drug solutions by gavage once a day for 14 consecutive days. The rat body weights and fecal condition were observed every day， and the Bristol score was recorded. Enzyme-linked immunosorbent assay （ELISA） was used to determine the levels of 5-hydroxytryptamine （5-HT） in serum and colon tissue. Transmission electron microscopy was used to observe the microvilli and tight junctions in the colon. The integrity of the colonic barrier， intestinal motility， and expression of related pathway proteins were evaluated by hematoxylin-eosin （HE） staining， immunohistochemistry， and Western blot. ResultsCompared with those in the normal control group， rats in the model group showed a significantly decreased body weight and increased diarrhea rate， diarrhea grade， and Bristol score （P<0.01）. HE staining revealed incomplete colonic mucosa in the model group， with evident congestion and edema observed. Electron microscopy results indicated decreased density and integrity of the colonic barrier， shedding and disappearance of microvilli， and significant widening of tight junctions. The expression levels of colonic tight junction proteins Occludin and Claudin-5 were downregulated （P<0.01）， and the levels of 5-HT in serum and colon tissue were elevated （P<0.01）. The small intestine propulsion rate significantly increased （P<0.01）， and the expression of contractile proteins Ras homolog family member A （RhoA） and Rho-associated coiled-coil containing protein kinase 2 （ROCK2） in colon and phosphorylation of myosin light chain （MLC₂₀） were upregulated （P<0.01）. Compared with the model group， the treatment groups showed alleviated diarrhea， diarrhea-associated symptoms， and pathological manifestations of colon tissue to varying degrees. Specifically， high-dose XPC exhibited effectively relieved diarrhea， promoted recovery of colonic mucosal structure， significantly reduced congestion and edema， upregulated expression of Occludin and Claudin-5 （P<0.01）， decreased levels of 5-HT in serum and colon tissue （P<0.05，P<0.01）， significantly slowed small intestine propulsion rate （P<0.01）， and significantly downregulated expression of contractile proteins RhoA and ROCK2 in colon and phosphorylation of MLC₂₀ （P<0.05，P<0.01）. ConclusionXPC effectively alleviates symptoms of spleen deficiency and diarrhea and regulates the secretion of brain-gut peptide. The characteristics of XPC are mainly manifested in alleviating IBS-D with spleen deficiency from the aspects of protecting intestinal mucosa and inhibiting smooth muscle contraction， and the mechanism is closely related to the regulation of the 5-HT-RhoA/ROCK2 pathway expression.